FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623757_at:

>probe:Drosophila_2:1623757_at:146:543; Interrogation_Position=1352; Antisense; GGATTGATAACCACCCGGCTGAATG
>probe:Drosophila_2:1623757_at:452:123; Interrogation_Position=1396; Antisense; AGCCGCCTTGAGTTGGTCCAATGGA
>probe:Drosophila_2:1623757_at:454:399; Interrogation_Position=1454; Antisense; GACAGGCTGGATGACCGTGCAGATA
>probe:Drosophila_2:1623757_at:165:549; Interrogation_Position=1495; Antisense; GGAGTTGCGTTCCAACAGTGCCGAA
>probe:Drosophila_2:1623757_at:36:317; Interrogation_Position=1514; Antisense; GCCGAACGTCGCTCTAAGAACTGGT
>probe:Drosophila_2:1623757_at:445:383; Interrogation_Position=1531; Antisense; GAACTGGTAGACACTCCGGAACATG
>probe:Drosophila_2:1623757_at:20:327; Interrogation_Position=1614; Antisense; GCGATCTGCCAACCGGACAACGAAT
>probe:Drosophila_2:1623757_at:532:365; Interrogation_Position=1664; Antisense; GAATCTTGTGTTCACCTAGCCTAGA
>probe:Drosophila_2:1623757_at:381:725; Interrogation_Position=1699; Antisense; TTGGTAATTCTCTCAGCTTTTCGAC
>probe:Drosophila_2:1623757_at:520:115; Interrogation_Position=1713; Antisense; AGCTTTTCGACCCATCTAATGCATA
>probe:Drosophila_2:1623757_at:519:107; Interrogation_Position=1753; Antisense; AGAATCTAACCCAAGCTCTAACGCT
>probe:Drosophila_2:1623757_at:307:1; Interrogation_Position=1776; Antisense; CTTTCCATTCCGCTAACTTTAGTTG
>probe:Drosophila_2:1623757_at:318:371; Interrogation_Position=1886; Antisense; GAAGGCTGCTGGACTTCAACTAAGT
>probe:Drosophila_2:1623757_at:500:219; Interrogation_Position=1907; Antisense; AAGTCGGCATGCTCTTTTGCAAAAC

Paste this into a BLAST search page for me
GGATTGATAACCACCCGGCTGAATGAGCCGCCTTGAGTTGGTCCAATGGAGACAGGCTGGATGACCGTGCAGATAGGAGTTGCGTTCCAACAGTGCCGAAGCCGAACGTCGCTCTAAGAACTGGTGAACTGGTAGACACTCCGGAACATGGCGATCTGCCAACCGGACAACGAATGAATCTTGTGTTCACCTAGCCTAGATTGGTAATTCTCTCAGCTTTTCGACAGCTTTTCGACCCATCTAATGCATAAGAATCTAACCCAAGCTCTAACGCTCTTTCCATTCCGCTAACTTTAGTTGGAAGGCTGCTGGACTTCAACTAAGTAAGTCGGCATGCTCTTTTGCAAAAC

Full Affymetrix probeset data:

Annotations for 1623757_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720