FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623758_at:

>probe:Drosophila_2:1623758_at:243:357; Interrogation_Position=1013; Antisense; GCACAGGTGGCACTGCTGGATTACA
>probe:Drosophila_2:1623758_at:728:665; Interrogation_Position=1034; Antisense; TACAGGCCAGCCAGTCAGGATCGGG
>probe:Drosophila_2:1623758_at:647:545; Interrogation_Position=1051; Antisense; GGATCGGGATAATCCGCGCTCATAA
>probe:Drosophila_2:1623758_at:681:407; Interrogation_Position=526; Antisense; GACGGATAGCTGTACGAAACCCTCT
>probe:Drosophila_2:1623758_at:227:333; Interrogation_Position=556; Antisense; GCTGGCCAACCAAGATTCGCTGATT
>probe:Drosophila_2:1623758_at:629:5; Interrogation_Position=578; Antisense; ATTGTCTCCGAGTTTTTACCTGCCA
>probe:Drosophila_2:1623758_at:539:545; Interrogation_Position=622; Antisense; GGATCTATCCGACTCTCAGCTGGAG
>probe:Drosophila_2:1623758_at:88:683; Interrogation_Position=686; Antisense; TATGCTGCCGTCGAACTGAAACACT
>probe:Drosophila_2:1623758_at:504:683; Interrogation_Position=806; Antisense; TATGCCTCGCCTCAATATCTGAAAA
>probe:Drosophila_2:1623758_at:62:683; Interrogation_Position=821; Antisense; TATCTGAAAACCCACGTGCGCAATT
>probe:Drosophila_2:1623758_at:537:245; Interrogation_Position=842; Antisense; AATTCGCACGTCTGCAAGTACTGCA
>probe:Drosophila_2:1623758_at:431:251; Interrogation_Position=880; Antisense; CAAGGTTCGCGATCTCAATGAGCAT
>probe:Drosophila_2:1623758_at:141:499; Interrogation_Position=938; Antisense; GTCTGCTCCAACAACTTTAGTACCA
>probe:Drosophila_2:1623758_at:453:163; Interrogation_Position=990; Antisense; AAATTCATGGAGTTCAGCTGCCCGC

Paste this into a BLAST search page for me
GCACAGGTGGCACTGCTGGATTACATACAGGCCAGCCAGTCAGGATCGGGGGATCGGGATAATCCGCGCTCATAAGACGGATAGCTGTACGAAACCCTCTGCTGGCCAACCAAGATTCGCTGATTATTGTCTCCGAGTTTTTACCTGCCAGGATCTATCCGACTCTCAGCTGGAGTATGCTGCCGTCGAACTGAAACACTTATGCCTCGCCTCAATATCTGAAAATATCTGAAAACCCACGTGCGCAATTAATTCGCACGTCTGCAAGTACTGCACAAGGTTCGCGATCTCAATGAGCATGTCTGCTCCAACAACTTTAGTACCAAAATTCATGGAGTTCAGCTGCCCGC

Full Affymetrix probeset data:

Annotations for 1623758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720