FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623759_at:

>probe:Drosophila_2:1623759_at:639:253; Interrogation_Position=113; Antisense; CAAAGTTCGTCGGTTTGTTCAGGCG
>probe:Drosophila_2:1623759_at:290:717; Interrogation_Position=118; Antisense; TTCGTCGGTTTGTTCAGGCGGGCAA
>probe:Drosophila_2:1623759_at:490:227; Interrogation_Position=141; Antisense; AAGGCGCCATGTCCCCGCAATGAAA
>probe:Drosophila_2:1623759_at:658:207; Interrogation_Position=16; Antisense; AAGCTACTCTGCGTTGTTTTGGTTA
>probe:Drosophila_2:1623759_at:683:611; Interrogation_Position=161; Antisense; TGAAAACCGCCCTTCTTCACGGCAA
>probe:Drosophila_2:1623759_at:697:295; Interrogation_Position=203; Antisense; CGAAATTCCGATCCCGTCGTGATAC
>probe:Drosophila_2:1623759_at:201:449; Interrogation_Position=212; Antisense; GATCCCGTCGTGATACATTGGAGGA
>probe:Drosophila_2:1623759_at:341:151; Interrogation_Position=226; Antisense; ACATTGGAGGACAAGCTCGTGGCCA
>probe:Drosophila_2:1623759_at:30:209; Interrogation_Position=238; Antisense; AAGCTCGTGGCCAATGATGATCCTC
>probe:Drosophila_2:1623759_at:241:349; Interrogation_Position=273; Antisense; GCAGTTCAGACAACGTCGTCAGGCT
>probe:Drosophila_2:1623759_at:106:199; Interrogation_Position=284; Antisense; AACGTCGTCAGGCTCCACCTGGAAT
>probe:Drosophila_2:1623759_at:703:473; Interrogation_Position=37; Antisense; GTTATTTACGTTGTGGCTCTGACCC
>probe:Drosophila_2:1623759_at:96:643; Interrogation_Position=54; Antisense; TCTGACCCTCTTCGGAGTCGATGGA
>probe:Drosophila_2:1623759_at:111:577; Interrogation_Position=99; Antisense; TGGAGTGGAGGAACCAAAGTTCGTC

Paste this into a BLAST search page for me
CAAAGTTCGTCGGTTTGTTCAGGCGTTCGTCGGTTTGTTCAGGCGGGCAAAAGGCGCCATGTCCCCGCAATGAAAAAGCTACTCTGCGTTGTTTTGGTTATGAAAACCGCCCTTCTTCACGGCAACGAAATTCCGATCCCGTCGTGATACGATCCCGTCGTGATACATTGGAGGAACATTGGAGGACAAGCTCGTGGCCAAAGCTCGTGGCCAATGATGATCCTCGCAGTTCAGACAACGTCGTCAGGCTAACGTCGTCAGGCTCCACCTGGAATGTTATTTACGTTGTGGCTCTGACCCTCTGACCCTCTTCGGAGTCGATGGATGGAGTGGAGGAACCAAAGTTCGTC

Full Affymetrix probeset data:

Annotations for 1623759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720