FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623760_at:

>probe:Drosophila_2:1623760_at:119:427; Interrogation_Position=1032; Antisense; GAGTTGTCAGATGTACCCTCAAATG
>probe:Drosophila_2:1623760_at:705:651; Interrogation_Position=1060; Antisense; TAATTAGCCCGTGGTTTCCGCAGCA
>probe:Drosophila_2:1623760_at:582:73; Interrogation_Position=1084; Antisense; AGGACATCCTTGCTCATCCAAACGT
>probe:Drosophila_2:1623760_at:579:173; Interrogation_Position=1109; Antisense; AAAGCTGTTTATTACTCATGGAGGC
>probe:Drosophila_2:1623760_at:584:369; Interrogation_Position=1149; Antisense; GAATGTATCCATCGTGGTGTACCGA
>probe:Drosophila_2:1623760_at:552:671; Interrogation_Position=1168; Antisense; TACCGATGCTGGGATTGCCGTTCTT
>probe:Drosophila_2:1623760_at:717:317; Interrogation_Position=1184; Antisense; GCCGTTCTTCTACGATCAGTTCAGA
>probe:Drosophila_2:1623760_at:608:203; Interrogation_Position=1225; Antisense; AAGCGCAGGGCATAGGTTTAGTTTT
>probe:Drosophila_2:1623760_at:212:559; Interrogation_Position=1283; Antisense; GGACACCATTCATCAGTTGCTGACA
>probe:Drosophila_2:1623760_at:5:157; Interrogation_Position=1338; Antisense; ACAGCGGACAGGTATCGGGATCAGC
>probe:Drosophila_2:1623760_at:2:369; Interrogation_Position=1367; Antisense; GAATCCTTTGGATACGGCGATCTGG
>probe:Drosophila_2:1623760_at:402:541; Interrogation_Position=1454; Antisense; GGATTTTATAACTTACCACAGCTTG
>probe:Drosophila_2:1623760_at:707:427; Interrogation_Position=1479; Antisense; GATGTTTTGGGAACTTTTCTCCTGG
>probe:Drosophila_2:1623760_at:543:523; Interrogation_Position=1510; Antisense; GGGCGATCCTTAGTATTGTTGTCCT

Paste this into a BLAST search page for me
GAGTTGTCAGATGTACCCTCAAATGTAATTAGCCCGTGGTTTCCGCAGCAAGGACATCCTTGCTCATCCAAACGTAAAGCTGTTTATTACTCATGGAGGCGAATGTATCCATCGTGGTGTACCGATACCGATGCTGGGATTGCCGTTCTTGCCGTTCTTCTACGATCAGTTCAGAAAGCGCAGGGCATAGGTTTAGTTTTGGACACCATTCATCAGTTGCTGACAACAGCGGACAGGTATCGGGATCAGCGAATCCTTTGGATACGGCGATCTGGGGATTTTATAACTTACCACAGCTTGGATGTTTTGGGAACTTTTCTCCTGGGGGCGATCCTTAGTATTGTTGTCCT

Full Affymetrix probeset data:

Annotations for 1623760_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720