FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623761_at:

>probe:Drosophila_2:1623761_at:667:545; Interrogation_Position=354; Antisense; GGATGCAATCGAAACACCTTCCCGT
>probe:Drosophila_2:1623761_at:40:87; Interrogation_Position=400; Antisense; AGTGCACAGGGAACTCGACCTCGTC
>probe:Drosophila_2:1623761_at:608:623; Interrogation_Position=429; Antisense; TGCGCCACAGAGACCTATGTATCGG
>probe:Drosophila_2:1623761_at:130:683; Interrogation_Position=444; Antisense; TATGTATCGGCCAAGATCTGCCCGC
>probe:Drosophila_2:1623761_at:314:321; Interrogation_Position=463; Antisense; GCCCGCTGTACAAGTTCGGCGACAA
>probe:Drosophila_2:1623761_at:362:9; Interrogation_Position=495; Antisense; ATTCGCAATAGCAATCGCACCGTGG
>probe:Drosophila_2:1623761_at:179:435; Interrogation_Position=600; Antisense; GAGGGACGCGGCTGCAACTTTCTGC
>probe:Drosophila_2:1623761_at:506:231; Interrogation_Position=630; Antisense; AATGATACCAACATTCCGCTGGCAC
>probe:Drosophila_2:1623761_at:12:399; Interrogation_Position=657; Antisense; GACAGCGGTGCCCAGTTGATCATCT
>probe:Drosophila_2:1623761_at:347:95; Interrogation_Position=670; Antisense; AGTTGATCATCTCCATGACGCTGCT
>probe:Drosophila_2:1623761_at:452:727; Interrogation_Position=706; Antisense; TTGTCGCCGCCTGGAGACTCTAAGA
>probe:Drosophila_2:1623761_at:371:405; Interrogation_Position=721; Antisense; GACTCTAAGATGTAACGACGGCCAG
>probe:Drosophila_2:1623761_at:627:555; Interrogation_Position=757; Antisense; GGACGAAAGTCAATCATGCCACAGA
>probe:Drosophila_2:1623761_at:394:625; Interrogation_Position=773; Antisense; TGCCACAGACCCAGTTCTTTTAGAA

Paste this into a BLAST search page for me
GGATGCAATCGAAACACCTTCCCGTAGTGCACAGGGAACTCGACCTCGTCTGCGCCACAGAGACCTATGTATCGGTATGTATCGGCCAAGATCTGCCCGCGCCCGCTGTACAAGTTCGGCGACAAATTCGCAATAGCAATCGCACCGTGGGAGGGACGCGGCTGCAACTTTCTGCAATGATACCAACATTCCGCTGGCACGACAGCGGTGCCCAGTTGATCATCTAGTTGATCATCTCCATGACGCTGCTTTGTCGCCGCCTGGAGACTCTAAGAGACTCTAAGATGTAACGACGGCCAGGGACGAAAGTCAATCATGCCACAGATGCCACAGACCCAGTTCTTTTAGAA

Full Affymetrix probeset data:

Annotations for 1623761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720