FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623762_at:

>probe:Drosophila_2:1623762_at:134:177; Interrogation_Position=1026; Antisense; AAACGATATCTACCGCAGGGACTTT
>probe:Drosophila_2:1623762_at:289:265; Interrogation_Position=1096; Antisense; CAGTATCTTATGGACTTGCGATCAT
>probe:Drosophila_2:1623762_at:557:115; Interrogation_Position=1139; Antisense; AGCTTATCGAAGCTCTGGCCGAGTC
>probe:Drosophila_2:1623762_at:212:581; Interrogation_Position=1154; Antisense; TGGCCGAGTCCCACAAGGCAAGCAA
>probe:Drosophila_2:1623762_at:405:343; Interrogation_Position=1192; Antisense; GCTTCTCCGCTGAGTTCAAGCAGAA
>probe:Drosophila_2:1623762_at:34:421; Interrogation_Position=1231; Antisense; GAGCAGAGACCAATTCTCGACCCAA
>probe:Drosophila_2:1623762_at:679:557; Interrogation_Position=1271; Antisense; GGACTTCAGACACCACTTTGCGATG
>probe:Drosophila_2:1623762_at:388:293; Interrogation_Position=1291; Antisense; CGATGTCCGATCTGTTCAAAGTCCT
>probe:Drosophila_2:1623762_at:256:649; Interrogation_Position=1306; Antisense; TCAAAGTCCTTTAACGCCTTAAGCG
>probe:Drosophila_2:1623762_at:151:135; Interrogation_Position=1319; Antisense; ACGCCTTAAGCGTGCTTCAGAGTCA
>probe:Drosophila_2:1623762_at:432:641; Interrogation_Position=826; Antisense; TCTGAGAAACAGTCCCTGATCGACA
>probe:Drosophila_2:1623762_at:437:285; Interrogation_Position=841; Antisense; CTGATCGACAACATGCGCGTGGAGA
>probe:Drosophila_2:1623762_at:303:239; Interrogation_Position=886; Antisense; AATCACTCGTTTGAGTTCGTACCAG
>probe:Drosophila_2:1623762_at:333:487; Interrogation_Position=904; Antisense; GTACCAGAGTATGCAACCGAATCAA

Paste this into a BLAST search page for me
AAACGATATCTACCGCAGGGACTTTCAGTATCTTATGGACTTGCGATCATAGCTTATCGAAGCTCTGGCCGAGTCTGGCCGAGTCCCACAAGGCAAGCAAGCTTCTCCGCTGAGTTCAAGCAGAAGAGCAGAGACCAATTCTCGACCCAAGGACTTCAGACACCACTTTGCGATGCGATGTCCGATCTGTTCAAAGTCCTTCAAAGTCCTTTAACGCCTTAAGCGACGCCTTAAGCGTGCTTCAGAGTCATCTGAGAAACAGTCCCTGATCGACACTGATCGACAACATGCGCGTGGAGAAATCACTCGTTTGAGTTCGTACCAGGTACCAGAGTATGCAACCGAATCAA

Full Affymetrix probeset data:

Annotations for 1623762_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720