Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623763_at:

>probe:Drosophila_2:1623763_at:561:93; Interrogation_Position=105; Antisense; AGTTGTGGCCAAAGACCCTGATACA
>probe:Drosophila_2:1623763_at:598:55; Interrogation_Position=13; Antisense; ATGAAATCGCTGGACACCTGGCTAT
>probe:Drosophila_2:1623763_at:496:611; Interrogation_Position=140; Antisense; TGACGGCGCGCTTCTGCCAACTGGA
>probe:Drosophila_2:1623763_at:613:639; Interrogation_Position=175; Antisense; TCGGATGCCTGCGAGATCCTGCGTA
>probe:Drosophila_2:1623763_at:485:97; Interrogation_Position=188; Antisense; AGATCCTGCGTACCAAGCTTCGCAT
>probe:Drosophila_2:1623763_at:230:559; Interrogation_Position=24; Antisense; GGACACCTGGCTATTTGACTTGAAT
>probe:Drosophila_2:1623763_at:573:265; Interrogation_Position=308; Antisense; CAGAGGATGCGTTCTTCTGCGGCAT
>probe:Drosophila_2:1623763_at:653:569; Interrogation_Position=328; Antisense; GGCATCTGTAAATCGCATCGCTGCA
>probe:Drosophila_2:1623763_at:126:237; Interrogation_Position=338; Antisense; AATCGCATCGCTGCAATGGTGCGGC
>probe:Drosophila_2:1623763_at:211:493; Interrogation_Position=367; Antisense; GTAACGCTTTCCTTGGCTACGATTC
>probe:Drosophila_2:1623763_at:704:273; Interrogation_Position=378; Antisense; CTTGGCTACGATTCTGGCCATGATT
>probe:Drosophila_2:1623763_at:319:465; Interrogation_Position=399; Antisense; GATTGCGCTCCAATTGGGCTGCTAA
>probe:Drosophila_2:1623763_at:241:473; Interrogation_Position=51; Antisense; GTTCTCATATTTCGATAATGGCGCC
>probe:Drosophila_2:1623763_at:352:183; Interrogation_Position=79; Antisense; AAAAGTCCGCTCATGAATTGCCAAA

Paste this into a BLAST search page for me
AGTTGTGGCCAAAGACCCTGATACAATGAAATCGCTGGACACCTGGCTATTGACGGCGCGCTTCTGCCAACTGGATCGGATGCCTGCGAGATCCTGCGTAAGATCCTGCGTACCAAGCTTCGCATGGACACCTGGCTATTTGACTTGAATCAGAGGATGCGTTCTTCTGCGGCATGGCATCTGTAAATCGCATCGCTGCAAATCGCATCGCTGCAATGGTGCGGCGTAACGCTTTCCTTGGCTACGATTCCTTGGCTACGATTCTGGCCATGATTGATTGCGCTCCAATTGGGCTGCTAAGTTCTCATATTTCGATAATGGCGCCAAAAGTCCGCTCATGAATTGCCAAA

Full Affymetrix probeset data:

Annotations for 1623763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime