Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623764_at:

>probe:Drosophila_2:1623764_at:631:653; Interrogation_Position=1065; Antisense; TAATCACGACTGGTTCCGTGCTGAT
>probe:Drosophila_2:1623764_at:522:431; Interrogation_Position=1140; Antisense; GAGTCGACTCAAGGCCACAATGTTC
>probe:Drosophila_2:1623764_at:435:59; Interrogation_Position=1159; Antisense; ATGTTCCTGAACATCTCACTGGTCA
>probe:Drosophila_2:1623764_at:95:453; Interrogation_Position=1192; Antisense; GATCTCTTGCAACTCTCGTACAAAT
>probe:Drosophila_2:1623764_at:690:399; Interrogation_Position=685; Antisense; GACATGTTAATGTGCGCCCTGGTCA
>probe:Drosophila_2:1623764_at:440:695; Interrogation_Position=737; Antisense; TTTCCGCTCACATCGAGAGTCATGT
>probe:Drosophila_2:1623764_at:308:3; Interrogation_Position=769; Antisense; ATTGGCTCATTCCAGCACGATTTGG
>probe:Drosophila_2:1623764_at:441:521; Interrogation_Position=811; Antisense; GTGGCGTATCACCAGAGCTTGATCC
>probe:Drosophila_2:1623764_at:681:7; Interrogation_Position=861; Antisense; ATTCGGTGTTTCACTGTTGTCCAAC
>probe:Drosophila_2:1623764_at:142:603; Interrogation_Position=875; Antisense; TGTTGTCCAACTTTGTATCCTCGTC
>probe:Drosophila_2:1623764_at:630:683; Interrogation_Position=890; Antisense; TATCCTCGTCGTTTATCATCTGCTT
>probe:Drosophila_2:1623764_at:665:343; Interrogation_Position=911; Antisense; GCTTCGTGGGTTTCCAGATGACCAT
>probe:Drosophila_2:1623764_at:263:493; Interrogation_Position=958; Antisense; GTAATGCTTGTGCTTTTCCTGTTTT
>probe:Drosophila_2:1623764_at:160:703; Interrogation_Position=979; Antisense; TTTTGTGCCATGGTTCAGGTCTTCA

Paste this into a BLAST search page for me
TAATCACGACTGGTTCCGTGCTGATGAGTCGACTCAAGGCCACAATGTTCATGTTCCTGAACATCTCACTGGTCAGATCTCTTGCAACTCTCGTACAAATGACATGTTAATGTGCGCCCTGGTCATTTCCGCTCACATCGAGAGTCATGTATTGGCTCATTCCAGCACGATTTGGGTGGCGTATCACCAGAGCTTGATCCATTCGGTGTTTCACTGTTGTCCAACTGTTGTCCAACTTTGTATCCTCGTCTATCCTCGTCGTTTATCATCTGCTTGCTTCGTGGGTTTCCAGATGACCATGTAATGCTTGTGCTTTTCCTGTTTTTTTTGTGCCATGGTTCAGGTCTTCA

Full Affymetrix probeset data:

Annotations for 1623764_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime