FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623765_at:

>probe:Drosophila_2:1623765_at:478:1; Interrogation_Position=100; Antisense; CAGTTTTTCCAACACGTTCGAGCGT
>probe:Drosophila_2:1623765_at:439:255; Interrogation_Position=109; Antisense; CAACACGTTCGAGCGTTTCAAGCAG
>probe:Drosophila_2:1623765_at:248:717; Interrogation_Position=116; Antisense; TTCGAGCGTTTCAAGCAGACTGGTG
>probe:Drosophila_2:1623765_at:392:651; Interrogation_Position=126; Antisense; TCAAGCAGACTGGTGGGAGGACTCA
>probe:Drosophila_2:1623765_at:69:61; Interrogation_Position=13; Antisense; ATGTCATTTCCTCGGATCATTTTTT
>probe:Drosophila_2:1623765_at:350:529; Interrogation_Position=140; Antisense; GGGAGGACTCAGTTATCCTGATGAA
>probe:Drosophila_2:1623765_at:266:91; Interrogation_Position=150; Antisense; AGTTATCCTGATGAAGAGAATGTTG
>probe:Drosophila_2:1623765_at:709:697; Interrogation_Position=33; Antisense; TTTTTTCCTTGTGTTGCTGGCATTT
>probe:Drosophila_2:1623765_at:412:629; Interrogation_Position=38; Antisense; TCCTTGTGTTGCTGGCATTTGCCAG
>probe:Drosophila_2:1623765_at:126:571; Interrogation_Position=51; Antisense; GGCATTTGCCAGGAGTGATCCTGTT
>probe:Drosophila_2:1623765_at:507:549; Interrogation_Position=62; Antisense; GGAGTGATCCTGTTGAAAGGAATAC
>probe:Drosophila_2:1623765_at:653:71; Interrogation_Position=79; Antisense; AGGAATACGGAAGCCATTTGCCAGT
>probe:Drosophila_2:1623765_at:435:379; Interrogation_Position=88; Antisense; GAAGCCATTTGCCAGTTTTTCCAAC
>probe:Drosophila_2:1623765_at:60:721; Interrogation_Position=96; Antisense; TTGCCAGTTTTTCCAACACGTTCGA

Paste this into a BLAST search page for me
CAGTTTTTCCAACACGTTCGAGCGTCAACACGTTCGAGCGTTTCAAGCAGTTCGAGCGTTTCAAGCAGACTGGTGTCAAGCAGACTGGTGGGAGGACTCAATGTCATTTCCTCGGATCATTTTTTGGGAGGACTCAGTTATCCTGATGAAAGTTATCCTGATGAAGAGAATGTTGTTTTTTCCTTGTGTTGCTGGCATTTTCCTTGTGTTGCTGGCATTTGCCAGGGCATTTGCCAGGAGTGATCCTGTTGGAGTGATCCTGTTGAAAGGAATACAGGAATACGGAAGCCATTTGCCAGTGAAGCCATTTGCCAGTTTTTCCAACTTGCCAGTTTTTCCAACACGTTCGA

Full Affymetrix probeset data:

Annotations for 1623765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720