FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623766_at:

>probe:Drosophila_2:1623766_at:493:119; Interrogation_Position=342; Antisense; AGCGGAACCGCCAGCTCAGGAATCT
>probe:Drosophila_2:1623766_at:149:237; Interrogation_Position=362; Antisense; AATCTGGCGCTGGATAAATCTGACC
>probe:Drosophila_2:1623766_at:444:165; Interrogation_Position=377; Antisense; AAATCTGACCTCTTCGAGTCACGAA
>probe:Drosophila_2:1623766_at:110:431; Interrogation_Position=392; Antisense; GAGTCACGAACTGCCATGCTGTGCT
>probe:Drosophila_2:1623766_at:102:305; Interrogation_Position=418; Antisense; CCGAGCTTTCGACATCAGTCAGGAA
>probe:Drosophila_2:1623766_at:484:423; Interrogation_Position=476; Antisense; GAGAACGCCTGCACTGAACTTCGAA
>probe:Drosophila_2:1623766_at:489:613; Interrogation_Position=490; Antisense; TGAACTTCGAAGTCGCATCCTGGAC
>probe:Drosophila_2:1623766_at:405:47; Interrogation_Position=506; Antisense; ATCCTGGACGTAAAGCTGCGACGCA
>probe:Drosophila_2:1623766_at:356:573; Interrogation_Position=543; Antisense; GGCTCCTCTGCCACGAGATACAGAA
>probe:Drosophila_2:1623766_at:46:293; Interrogation_Position=613; Antisense; CGTCTGGCACAGACTTTGTTTCCTA
>probe:Drosophila_2:1623766_at:268:185; Interrogation_Position=713; Antisense; AAAATGGATGCCCTCAATCTCTTCG
>probe:Drosophila_2:1623766_at:560:715; Interrogation_Position=734; Antisense; TTCGTGGCGGGCTTCTGACATGTTC
>probe:Drosophila_2:1623766_at:417:663; Interrogation_Position=785; Antisense; TAAACACTGGTTATCGAGCACCGCC
>probe:Drosophila_2:1623766_at:74:113; Interrogation_Position=801; Antisense; AGCACCGCCGAGTTATCGACAGTAA

Paste this into a BLAST search page for me
AGCGGAACCGCCAGCTCAGGAATCTAATCTGGCGCTGGATAAATCTGACCAAATCTGACCTCTTCGAGTCACGAAGAGTCACGAACTGCCATGCTGTGCTCCGAGCTTTCGACATCAGTCAGGAAGAGAACGCCTGCACTGAACTTCGAATGAACTTCGAAGTCGCATCCTGGACATCCTGGACGTAAAGCTGCGACGCAGGCTCCTCTGCCACGAGATACAGAACGTCTGGCACAGACTTTGTTTCCTAAAAATGGATGCCCTCAATCTCTTCGTTCGTGGCGGGCTTCTGACATGTTCTAAACACTGGTTATCGAGCACCGCCAGCACCGCCGAGTTATCGACAGTAA

Full Affymetrix probeset data:

Annotations for 1623766_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720