Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623767_at:

>probe:Drosophila_2:1623767_at:475:113; Interrogation_Position=3478; Antisense; AGCAGCTACTCAAGTGCCGTGGGCA
>probe:Drosophila_2:1623767_at:517:303; Interrogation_Position=3494; Antisense; CCGTGGGCACCATCAGTGGCATTGT
>probe:Drosophila_2:1623767_at:399:647; Interrogation_Position=3506; Antisense; TCAGTGGCATTGTGGCCAGCATTTT
>probe:Drosophila_2:1623767_at:440:579; Interrogation_Position=3552; Antisense; GGCCATTGTGTTCTATCGCCGACAG
>probe:Drosophila_2:1623767_at:522:399; Interrogation_Position=3572; Antisense; GACAGCGCTCCAGCTATGGCAAATC
>probe:Drosophila_2:1623767_at:127:565; Interrogation_Position=3589; Antisense; GGCAAATCGGCCAACGGCAATGTGG
>probe:Drosophila_2:1623767_at:128:521; Interrogation_Position=3610; Antisense; GTGGCGTTTGAGAATCCCACCTACA
>probe:Drosophila_2:1623767_at:445:151; Interrogation_Position=3670; Antisense; ACATCGGCCATCACGACGCAAAATG
>probe:Drosophila_2:1623767_at:270:229; Interrogation_Position=3691; Antisense; AATGGCAACCACCACGGGATGAGCA
>probe:Drosophila_2:1623767_at:672:495; Interrogation_Position=3749; Antisense; GTCATGGTCGTAATGGCATCGCCGC
>probe:Drosophila_2:1623767_at:296:33; Interrogation_Position=3778; Antisense; ATGACGACATCCACAACGACAACGG
>probe:Drosophila_2:1623767_at:84:99; Interrogation_Position=3924; Antisense; AGATGCGGCGCATCACTTTCATAAC
>probe:Drosophila_2:1623767_at:545:29; Interrogation_Position=3944; Antisense; ATAACCCGCTCAGCAATACGCAGTG
>probe:Drosophila_2:1623767_at:287:615; Interrogation_Position=3993; Antisense; TGAAGAGCTCAAACTTGGCCAAGAA

Paste this into a BLAST search page for me
AGCAGCTACTCAAGTGCCGTGGGCACCGTGGGCACCATCAGTGGCATTGTTCAGTGGCATTGTGGCCAGCATTTTGGCCATTGTGTTCTATCGCCGACAGGACAGCGCTCCAGCTATGGCAAATCGGCAAATCGGCCAACGGCAATGTGGGTGGCGTTTGAGAATCCCACCTACAACATCGGCCATCACGACGCAAAATGAATGGCAACCACCACGGGATGAGCAGTCATGGTCGTAATGGCATCGCCGCATGACGACATCCACAACGACAACGGAGATGCGGCGCATCACTTTCATAACATAACCCGCTCAGCAATACGCAGTGTGAAGAGCTCAAACTTGGCCAAGAA

Full Affymetrix probeset data:

Annotations for 1623767_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime