FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623768_at:

>probe:Drosophila_2:1623768_at:330:127; Interrogation_Position=129; Antisense; AGCCACAGCACATCGCAGACATAAA
>probe:Drosophila_2:1623768_at:632:121; Interrogation_Position=205; Antisense; AGCGGACGAGCGACATACATGCGAA
>probe:Drosophila_2:1623768_at:286:657; Interrogation_Position=220; Antisense; TACATGCGAACCAGTACGGGTATGC
>probe:Drosophila_2:1623768_at:712:139; Interrogation_Position=235; Antisense; ACGGGTATGCACGAGTATGTACATC
>probe:Drosophila_2:1623768_at:227:601; Interrogation_Position=272; Antisense; TGTACATCGGTATGTCTCCTGCAAC
>probe:Drosophila_2:1623768_at:481:631; Interrogation_Position=288; Antisense; TCCTGCAACTCATTCAAACTCATTT
>probe:Drosophila_2:1623768_at:495:711; Interrogation_Position=300; Antisense; TTCAAACTCATTTCTATACACCCCG
>probe:Drosophila_2:1623768_at:379:463; Interrogation_Position=389; Antisense; GATTCTGGTTCTATATCTTTGCCCC
>probe:Drosophila_2:1623768_at:75:561; Interrogation_Position=420; Antisense; GGAACCGACTGGTCAGCCGCATAAG
>probe:Drosophila_2:1623768_at:550:567; Interrogation_Position=445; Antisense; TGGCAATTACAATATGGCAACCGGT
>probe:Drosophila_2:1623768_at:39:183; Interrogation_Position=474; Antisense; AAAACTGTTTTTAATGCCAGCATTA
>probe:Drosophila_2:1623768_at:570:497; Interrogation_Position=517; Antisense; GTCTTGCCAAAGATCGATGTCCAGG
>probe:Drosophila_2:1623768_at:125:599; Interrogation_Position=551; Antisense; TGTCGCATGTCTAGAAAACCGCAAG
>probe:Drosophila_2:1623768_at:455:297; Interrogation_Position=570; Antisense; CGCAAGAGTACATACATCGGCTACT

Paste this into a BLAST search page for me
AGCCACAGCACATCGCAGACATAAAAGCGGACGAGCGACATACATGCGAATACATGCGAACCAGTACGGGTATGCACGGGTATGCACGAGTATGTACATCTGTACATCGGTATGTCTCCTGCAACTCCTGCAACTCATTCAAACTCATTTTTCAAACTCATTTCTATACACCCCGGATTCTGGTTCTATATCTTTGCCCCGGAACCGACTGGTCAGCCGCATAAGTGGCAATTACAATATGGCAACCGGTAAAACTGTTTTTAATGCCAGCATTAGTCTTGCCAAAGATCGATGTCCAGGTGTCGCATGTCTAGAAAACCGCAAGCGCAAGAGTACATACATCGGCTACT

Full Affymetrix probeset data:

Annotations for 1623768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720