FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623769_at:

>probe:Drosophila_2:1623769_at:423:281; Interrogation_Position=314; Antisense; CTCTGCTGGACGGTCTGGTCAACAA
>probe:Drosophila_2:1623769_at:65:17; Interrogation_Position=386; Antisense; ATTTCGACACCCACTTCGATGTGAA
>probe:Drosophila_2:1623769_at:457:227; Interrogation_Position=415; Antisense; AAGGCGGTGTTCAATGTCACCCAAT
>probe:Drosophila_2:1623769_at:711:407; Interrogation_Position=460; Antisense; GACGGAGCCTCAATTGTCAACGTGT
>probe:Drosophila_2:1623769_at:256:495; Interrogation_Position=475; Antisense; GTCAACGTGTCCTCGATAGCGTCAT
>probe:Drosophila_2:1623769_at:352:727; Interrogation_Position=574; Antisense; TTGGAGCTGGGTCCGCGCAAAATTC
>probe:Drosophila_2:1623769_at:108:359; Interrogation_Position=590; Antisense; GCAAAATTCGCGTCAATTCCGTTAA
>probe:Drosophila_2:1623769_at:280:335; Interrogation_Position=627; Antisense; GCTGACCAAAATGGGCGCCGACAAT
>probe:Drosophila_2:1623769_at:608:247; Interrogation_Position=649; Antisense; AATTGGTCGGATCCCGCCAAGAGTG
>probe:Drosophila_2:1623769_at:709:297; Interrogation_Position=695; Antisense; CGCTGAATCGGTTCTGCGAGGTGCA
>probe:Drosophila_2:1623769_at:326:361; Interrogation_Position=755; Antisense; GCAAGTCGAGCTTCGTGAACGGCCA
>probe:Drosophila_2:1623769_at:160:127; Interrogation_Position=779; Antisense; ACCACATCCTGCTCGAAGGTGGATA
>probe:Drosophila_2:1623769_at:229:541; Interrogation_Position=799; Antisense; GGATATTCCGTTTCCTAAGACGCCA
>probe:Drosophila_2:1623769_at:654:103; Interrogation_Position=816; Antisense; AGACGCCAGCGTTAACTTCAATGTG

Paste this into a BLAST search page for me
CTCTGCTGGACGGTCTGGTCAACAAATTTCGACACCCACTTCGATGTGAAAAGGCGGTGTTCAATGTCACCCAATGACGGAGCCTCAATTGTCAACGTGTGTCAACGTGTCCTCGATAGCGTCATTTGGAGCTGGGTCCGCGCAAAATTCGCAAAATTCGCGTCAATTCCGTTAAGCTGACCAAAATGGGCGCCGACAATAATTGGTCGGATCCCGCCAAGAGTGCGCTGAATCGGTTCTGCGAGGTGCAGCAAGTCGAGCTTCGTGAACGGCCAACCACATCCTGCTCGAAGGTGGATAGGATATTCCGTTTCCTAAGACGCCAAGACGCCAGCGTTAACTTCAATGTG

Full Affymetrix probeset data:

Annotations for 1623769_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720