FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623770_at:

>probe:Drosophila_2:1623770_at:634:81; Interrogation_Position=1970; Antisense; AGGGCCGATTCGTTAAGTTGCATTT
>probe:Drosophila_2:1623770_at:583:5; Interrogation_Position=2030; Antisense; ATTGTACATAATTCCAACTGGTTCA
>probe:Drosophila_2:1623770_at:100:713; Interrogation_Position=2082; Antisense; TTCATATTTTTAGTTGTGCGCCTTT
>probe:Drosophila_2:1623770_at:498:467; Interrogation_Position=2094; Antisense; GTTGTGCGCCTTTAGATATATATAT
>probe:Drosophila_2:1623770_at:34:55; Interrogation_Position=2153; Antisense; ATGAATCGTCTTTTTGCGCTTTTAC
>probe:Drosophila_2:1623770_at:267:723; Interrogation_Position=2166; Antisense; TTGCGCTTTTACTTCCAAGCAGCAT
>probe:Drosophila_2:1623770_at:127:173; Interrogation_Position=2281; Antisense; AAACGTACCGGAGGCGAAATGCATT
>probe:Drosophila_2:1623770_at:464:513; Interrogation_Position=2319; Antisense; GTGATCGAAGCGTTCTTGGAGGTAA
>probe:Drosophila_2:1623770_at:545:113; Interrogation_Position=2368; Antisense; AGCAGCCGAGCTGAGCTGTGACTAA
>probe:Drosophila_2:1623770_at:654:207; Interrogation_Position=2392; Antisense; AAGCTAATCTGAACCTGAACCCGTC
>probe:Drosophila_2:1623770_at:210:611; Interrogation_Position=2407; Antisense; TGAACCCGTCAGTAGAACCTAGGCC
>probe:Drosophila_2:1623770_at:327:273; Interrogation_Position=2425; Antisense; CTAGGCCTAGGCTGTAGATACTAAA
>probe:Drosophila_2:1623770_at:372:175; Interrogation_Position=2447; Antisense; AAACCCGAATCAAGCTGTATACTAT
>probe:Drosophila_2:1623770_at:59:491; Interrogation_Position=2476; Antisense; GTAACACCTAGTTGATAAGCGAACC

Paste this into a BLAST search page for me
AGGGCCGATTCGTTAAGTTGCATTTATTGTACATAATTCCAACTGGTTCATTCATATTTTTAGTTGTGCGCCTTTGTTGTGCGCCTTTAGATATATATATATGAATCGTCTTTTTGCGCTTTTACTTGCGCTTTTACTTCCAAGCAGCATAAACGTACCGGAGGCGAAATGCATTGTGATCGAAGCGTTCTTGGAGGTAAAGCAGCCGAGCTGAGCTGTGACTAAAAGCTAATCTGAACCTGAACCCGTCTGAACCCGTCAGTAGAACCTAGGCCCTAGGCCTAGGCTGTAGATACTAAAAAACCCGAATCAAGCTGTATACTATGTAACACCTAGTTGATAAGCGAACC

Full Affymetrix probeset data:

Annotations for 1623770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720