Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623771_at:

>probe:Drosophila_2:1623771_at:638:419; Interrogation_Position=1043; Antisense; GAGACACTTGTGAACTTTCGAACTA
>probe:Drosophila_2:1623771_at:295:401; Interrogation_Position=520; Antisense; GACATGATTCGGGAGCTCTCCGGCA
>probe:Drosophila_2:1623771_at:495:133; Interrogation_Position=544; Antisense; ACGCTGACCAGTGTCAAGCACGAAC
>probe:Drosophila_2:1623771_at:215:77; Interrogation_Position=569; Antisense; AGGAGTACATGCATGTGCGCGACAA
>probe:Drosophila_2:1623771_at:730:623; Interrogation_Position=584; Antisense; TGCGCGACAAGATCCATCGTTCGGT
>probe:Drosophila_2:1623771_at:245:255; Interrogation_Position=621; Antisense; CAACTCGCGAGTGGTGCTGTGGTCC
>probe:Drosophila_2:1623771_at:196:639; Interrogation_Position=659; Antisense; TCGTCCTGGTCCTGATGACAGTGGG
>probe:Drosophila_2:1623771_at:458:603; Interrogation_Position=674; Antisense; TGACAGTGGGCCAGGTGTACTACCT
>probe:Drosophila_2:1623771_at:215:485; Interrogation_Position=690; Antisense; GTACTACCTGAAACGCTTCTTCGAG
>probe:Drosophila_2:1623771_at:359:275; Interrogation_Position=708; Antisense; CTTCGAGGTCAAGCGCGTCGTGTAA
>probe:Drosophila_2:1623771_at:255:327; Interrogation_Position=722; Antisense; GCGTCGTGTAATCCCGAGCGGAAAA
>probe:Drosophila_2:1623771_at:139:225; Interrogation_Position=764; Antisense; AAGGAAGGCGGCACACGAAGCTCTG
>probe:Drosophila_2:1623771_at:534:249; Interrogation_Position=804; Antisense; CAATGCGTTGCAGTCTCAGATTTAA
>probe:Drosophila_2:1623771_at:374:91; Interrogation_Position=895; Antisense; AGTATGTCGATCATGTTTCTGTTTC

Paste this into a BLAST search page for me
GAGACACTTGTGAACTTTCGAACTAGACATGATTCGGGAGCTCTCCGGCAACGCTGACCAGTGTCAAGCACGAACAGGAGTACATGCATGTGCGCGACAATGCGCGACAAGATCCATCGTTCGGTCAACTCGCGAGTGGTGCTGTGGTCCTCGTCCTGGTCCTGATGACAGTGGGTGACAGTGGGCCAGGTGTACTACCTGTACTACCTGAAACGCTTCTTCGAGCTTCGAGGTCAAGCGCGTCGTGTAAGCGTCGTGTAATCCCGAGCGGAAAAAAGGAAGGCGGCACACGAAGCTCTGCAATGCGTTGCAGTCTCAGATTTAAAGTATGTCGATCATGTTTCTGTTTC

Full Affymetrix probeset data:

Annotations for 1623771_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime