Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623773_at:

>probe:Drosophila_2:1623773_at:499:719; Interrogation_Position=3786; Antisense; TTCCGATGCGGAACTCAAGTCGACT
>probe:Drosophila_2:1623773_at:25:653; Interrogation_Position=3800; Antisense; TCAAGTCGACTAGTTCCGATCCCTA
>probe:Drosophila_2:1623773_at:283:719; Interrogation_Position=3813; Antisense; TTCCGATCCCTACGATTGCATCGTA
>probe:Drosophila_2:1623773_at:608:493; Interrogation_Position=3835; Antisense; GTAATCAATGATCACCTGGTGCGCA
>probe:Drosophila_2:1623773_at:542:251; Interrogation_Position=3858; Antisense; CAAGGACGACAAGATGCGGCGCCAT
>probe:Drosophila_2:1623773_at:629:263; Interrogation_Position=3892; Antisense; CAGCATCAGCAAATGGCGACCAATA
>probe:Drosophila_2:1623773_at:628:183; Interrogation_Position=3923; Antisense; AAAAGAGCTCCTCCAAGGACCAGGA
>probe:Drosophila_2:1623773_at:244:245; Interrogation_Position=3964; Antisense; AATTCGACGGCCAGTTCGGGAGCTC
>probe:Drosophila_2:1623773_at:695:159; Interrogation_Position=4103; Antisense; ACAAGAGCTACGGACCATGGTACGA
>probe:Drosophila_2:1623773_at:279:269; Interrogation_Position=4118; Antisense; CATGGTACGACTTCTGGGATCAGGA
>probe:Drosophila_2:1623773_at:549:529; Interrogation_Position=4133; Antisense; GGGATCAGGAACAGCATGGCCAGAA
>probe:Drosophila_2:1623773_at:709:213; Interrogation_Position=4156; Antisense; AAGTCGGCTAGTGCCAAGCTGAAGT
>probe:Drosophila_2:1623773_at:129:717; Interrogation_Position=4227; Antisense; TTCGCCGTCTTCTTACCGGATAAGA
>probe:Drosophila_2:1623773_at:560:269; Interrogation_Position=4319; Antisense; CTTACGTAAGAGTGATCCCCAGCAT

Paste this into a BLAST search page for me
TTCCGATGCGGAACTCAAGTCGACTTCAAGTCGACTAGTTCCGATCCCTATTCCGATCCCTACGATTGCATCGTAGTAATCAATGATCACCTGGTGCGCACAAGGACGACAAGATGCGGCGCCATCAGCATCAGCAAATGGCGACCAATAAAAAGAGCTCCTCCAAGGACCAGGAAATTCGACGGCCAGTTCGGGAGCTCACAAGAGCTACGGACCATGGTACGACATGGTACGACTTCTGGGATCAGGAGGGATCAGGAACAGCATGGCCAGAAAAGTCGGCTAGTGCCAAGCTGAAGTTTCGCCGTCTTCTTACCGGATAAGACTTACGTAAGAGTGATCCCCAGCAT

Full Affymetrix probeset data:

Annotations for 1623773_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime