FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623775_at:

>probe:Drosophila_2:1623775_at:663:371; Interrogation_Position=1009; Antisense; GAAGTCTACGGAACTCAGGAACCTC
>probe:Drosophila_2:1623775_at:34:563; Interrogation_Position=1026; Antisense; GGAACCTCCAGAGTATCCTGTAGAG
>probe:Drosophila_2:1623775_at:129:429; Interrogation_Position=1048; Antisense; GAGTTGATCAATTCCTTGGTGCACA
>probe:Drosophila_2:1623775_at:386:25; Interrogation_Position=1085; Antisense; ATAGTGACAATCTCGCCGCTGTGGA
>probe:Drosophila_2:1623775_at:472:651; Interrogation_Position=1143; Antisense; TAAGGTTATGCACCGCATGGCGGAT
>probe:Drosophila_2:1623775_at:419:541; Interrogation_Position=1185; Antisense; GGATTTCGCCCTGAACTGGGAGGTT
>probe:Drosophila_2:1623775_at:400:461; Interrogation_Position=689; Antisense; GATTAGTGCGTTCTGTGGGTCCATA
>probe:Drosophila_2:1623775_at:43:545; Interrogation_Position=748; Antisense; GGATCACAGGAGTTTTTGCCTCATA
>probe:Drosophila_2:1623775_at:296:57; Interrogation_Position=773; Antisense; ATGAGTTCCTCATGGCCATATTCTT
>probe:Drosophila_2:1623775_at:75:241; Interrogation_Position=799; Antisense; AATATCTGCCAACCGGACTTTATGT
>probe:Drosophila_2:1623775_at:403:277; Interrogation_Position=816; Antisense; CTTTATGTTGCGTCCAGTGTGTGAA
>probe:Drosophila_2:1623775_at:65:683; Interrogation_Position=888; Antisense; TATGCCGGAAGGTATGGCCACCCAT
>probe:Drosophila_2:1623775_at:677:469; Interrogation_Position=923; Antisense; GTTCCACCGACCAAATGTTGCACTA
>probe:Drosophila_2:1623775_at:211:531; Interrogation_Position=966; Antisense; GGGTTACTTCCGTCTATTTGATCAT

Paste this into a BLAST search page for me
GAAGTCTACGGAACTCAGGAACCTCGGAACCTCCAGAGTATCCTGTAGAGGAGTTGATCAATTCCTTGGTGCACAATAGTGACAATCTCGCCGCTGTGGATAAGGTTATGCACCGCATGGCGGATGGATTTCGCCCTGAACTGGGAGGTTGATTAGTGCGTTCTGTGGGTCCATAGGATCACAGGAGTTTTTGCCTCATAATGAGTTCCTCATGGCCATATTCTTAATATCTGCCAACCGGACTTTATGTCTTTATGTTGCGTCCAGTGTGTGAATATGCCGGAAGGTATGGCCACCCATGTTCCACCGACCAAATGTTGCACTAGGGTTACTTCCGTCTATTTGATCAT

Full Affymetrix probeset data:

Annotations for 1623775_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720