FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623783_at:

>probe:Drosophila_2:1623783_at:559:511; Interrogation_Position=1069; Antisense; GTGACTATCACACTTTATTCAATAT
>probe:Drosophila_2:1623783_at:103:35; Interrogation_Position=1100; Antisense; ATCGAACTTCACTTACAGGTATCAG
>probe:Drosophila_2:1623783_at:664:163; Interrogation_Position=1147; Antisense; AAATAGAGACTACTCCCTCTTGCAG
>probe:Drosophila_2:1623783_at:422:273; Interrogation_Position=1165; Antisense; CTTGCAGCACCTACATAACGTACAT
>probe:Drosophila_2:1623783_at:125:603; Interrogation_Position=1205; Antisense; TGATTTTGATTTGCTTGCCGGCGGA
>probe:Drosophila_2:1623783_at:445:317; Interrogation_Position=1231; Antisense; GCCGATTGGCCTGAAGGCTACCGAA
>probe:Drosophila_2:1623783_at:560:585; Interrogation_Position=1291; Antisense; TGGAAGCCCCACATACGCCATGGAT
>probe:Drosophila_2:1623783_at:485:505; Interrogation_Position=730; Antisense; GTCCATATATCCAACCAGCCGATAT
>probe:Drosophila_2:1623783_at:448:261; Interrogation_Position=745; Antisense; CAGCCGATATGCATCCCATTAGTTA
>probe:Drosophila_2:1623783_at:1:271; Interrogation_Position=756; Antisense; CATCCCATTAGTTATCTTTCCTCTA
>probe:Drosophila_2:1623783_at:51:475; Interrogation_Position=805; Antisense; GTTACACCATAGTTATCTACCGCTC
>probe:Drosophila_2:1623783_at:39:673; Interrogation_Position=822; Antisense; TACCGCTCCACCAAGCTCAAAAAAG
>probe:Drosophila_2:1623783_at:553:103; Interrogation_Position=854; Antisense; AGACGTTACTTTACTGACTTACAGT
>probe:Drosophila_2:1623783_at:721:59; Interrogation_Position=885; Antisense; ATGTTTGCGGTTCAATCTTGTTCAA

Paste this into a BLAST search page for me
GTGACTATCACACTTTATTCAATATATCGAACTTCACTTACAGGTATCAGAAATAGAGACTACTCCCTCTTGCAGCTTGCAGCACCTACATAACGTACATTGATTTTGATTTGCTTGCCGGCGGAGCCGATTGGCCTGAAGGCTACCGAATGGAAGCCCCACATACGCCATGGATGTCCATATATCCAACCAGCCGATATCAGCCGATATGCATCCCATTAGTTACATCCCATTAGTTATCTTTCCTCTAGTTACACCATAGTTATCTACCGCTCTACCGCTCCACCAAGCTCAAAAAAGAGACGTTACTTTACTGACTTACAGTATGTTTGCGGTTCAATCTTGTTCAA

Full Affymetrix probeset data:

Annotations for 1623783_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720