FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623784_at:

>probe:Drosophila_2:1623784_at:683:19; Interrogation_Position=3975; Antisense; ATTTGCTGTTGAGCTTCCTACACTA
>probe:Drosophila_2:1623784_at:665:481; Interrogation_Position=4024; Antisense; GTATGCCATCTCGATACGGGTGGGT
>probe:Drosophila_2:1623784_at:706:515; Interrogation_Position=4050; Antisense; GTGTCCTGCCCATAGAGGTGTGCCG
>probe:Drosophila_2:1623784_at:304:199; Interrogation_Position=4112; Antisense; AACGAGCTGTGCATCGAAGAGCCAT
>probe:Drosophila_2:1623784_at:697:271; Interrogation_Position=4198; Antisense; CATCTTTGTGGCCAGCTACAGGAGA
>probe:Drosophila_2:1623784_at:291:39; Interrogation_Position=4239; Antisense; ATCTCAGTGCCATATTCGAGGACTA
>probe:Drosophila_2:1623784_at:337:441; Interrogation_Position=4265; Antisense; GATGGACCCACAATACTGATGCAGC
>probe:Drosophila_2:1623784_at:19:355; Interrogation_Position=4288; Antisense; GCAGCCATCGGTGGACTCAGAGATC
>probe:Drosophila_2:1623784_at:516:127; Interrogation_Position=4332; Antisense; ACCACCGTTTGCTACCGAATCGAGG
>probe:Drosophila_2:1623784_at:487:319; Interrogation_Position=4387; Antisense; GCCGCGTCCTTCAATACTAATGGTG
>probe:Drosophila_2:1623784_at:94:175; Interrogation_Position=4415; Antisense; AAAGCCACTACAGCCATTTGGGATG
>probe:Drosophila_2:1623784_at:539:453; Interrogation_Position=4457; Antisense; GATCACCCAGTATTAAGCCATAGCA
>probe:Drosophila_2:1623784_at:656:403; Interrogation_Position=4530; Antisense; GACTCAAGGATAACTCTGTGGCCGA
>probe:Drosophila_2:1623784_at:234:577; Interrogation_Position=4549; Antisense; GGCCGACAAGCCACCAATTGCGTAA

Paste this into a BLAST search page for me
ATTTGCTGTTGAGCTTCCTACACTAGTATGCCATCTCGATACGGGTGGGTGTGTCCTGCCCATAGAGGTGTGCCGAACGAGCTGTGCATCGAAGAGCCATCATCTTTGTGGCCAGCTACAGGAGAATCTCAGTGCCATATTCGAGGACTAGATGGACCCACAATACTGATGCAGCGCAGCCATCGGTGGACTCAGAGATCACCACCGTTTGCTACCGAATCGAGGGCCGCGTCCTTCAATACTAATGGTGAAAGCCACTACAGCCATTTGGGATGGATCACCCAGTATTAAGCCATAGCAGACTCAAGGATAACTCTGTGGCCGAGGCCGACAAGCCACCAATTGCGTAA

Full Affymetrix probeset data:

Annotations for 1623784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720