Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623787_at:

>probe:Drosophila_2:1623787_at:722:15; Interrogation_Position=2712; Antisense; ATTTTGTGGTCTACGGACAGCCCCA
>probe:Drosophila_2:1623787_at:429:303; Interrogation_Position=2745; Antisense; CCGCCATGGCGATGACTGTGGGCAA
>probe:Drosophila_2:1623787_at:237:315; Interrogation_Position=2777; Antisense; GCCATCGCAGCCAAAATGATCCTAG
>probe:Drosophila_2:1623787_at:100:513; Interrogation_Position=2805; Antisense; GTGAGATCCAGGAACGCGGCGTCCT
>probe:Drosophila_2:1623787_at:1:403; Interrogation_Position=2846; Antisense; GACATTTATCGTCCCATGCTGCAAC
>probe:Drosophila_2:1623787_at:166:251; Interrogation_Position=2867; Antisense; CAACGTCTGCGCTCCGAGGGTCTGA
>probe:Drosophila_2:1623787_at:270:435; Interrogation_Position=2882; Antisense; GAGGGTCTGACTGCCACGGAAACCT
>probe:Drosophila_2:1623787_at:668:259; Interrogation_Position=2896; Antisense; CACGGAAACCTCCAGATGGCTAAAT
>probe:Drosophila_2:1623787_at:208:221; Interrogation_Position=2922; Antisense; AAGTGATCTTAACTGATCCCGAGAA
>probe:Drosophila_2:1623787_at:349:131; Interrogation_Position=2989; Antisense; ACCGCGTCGGGTGATACTTCTTGTT
>probe:Drosophila_2:1623787_at:597:273; Interrogation_Position=3005; Antisense; CTTCTTGTTTTATCGCTCGGGTATT
>probe:Drosophila_2:1623787_at:325:299; Interrogation_Position=3018; Antisense; CGCTCGGGTATTTCGTTGTTTGATA
>probe:Drosophila_2:1623787_at:252:193; Interrogation_Position=3084; Antisense; AACTAGAGCTACTTGACGTACGTAA
>probe:Drosophila_2:1623787_at:587:139; Interrogation_Position=3152; Antisense; ACGTGAATTCACTACGAGCCTGATT

Paste this into a BLAST search page for me
ATTTTGTGGTCTACGGACAGCCCCACCGCCATGGCGATGACTGTGGGCAAGCCATCGCAGCCAAAATGATCCTAGGTGAGATCCAGGAACGCGGCGTCCTGACATTTATCGTCCCATGCTGCAACCAACGTCTGCGCTCCGAGGGTCTGAGAGGGTCTGACTGCCACGGAAACCTCACGGAAACCTCCAGATGGCTAAATAAGTGATCTTAACTGATCCCGAGAAACCGCGTCGGGTGATACTTCTTGTTCTTCTTGTTTTATCGCTCGGGTATTCGCTCGGGTATTTCGTTGTTTGATAAACTAGAGCTACTTGACGTACGTAAACGTGAATTCACTACGAGCCTGATT

Full Affymetrix probeset data:

Annotations for 1623787_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime