Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623788_at:

>probe:Drosophila_2:1623788_at:432:261; Interrogation_Position=1462; Antisense; CACCTTAAGGAACTGCAGCGCGCAT
>probe:Drosophila_2:1623788_at:502:11; Interrogation_Position=1485; Antisense; ATTCAAGAATCCCTCGGCCAATTTG
>probe:Drosophila_2:1623788_at:265:461; Interrogation_Position=1515; Antisense; GATTTTCAAAGAGGCCTCCAGGCGG
>probe:Drosophila_2:1623788_at:456:529; Interrogation_Position=1590; Antisense; GGGTGAACTCTTGCCTTATGCCAAA
>probe:Drosophila_2:1623788_at:657:141; Interrogation_Position=1618; Antisense; ACGGCCCATTGTATTGATCTTTTTG
>probe:Drosophila_2:1623788_at:680:361; Interrogation_Position=1741; Antisense; GCAATGGTTGTGACGCAATCGCGAT
>probe:Drosophila_2:1623788_at:551:453; Interrogation_Position=1763; Antisense; GATCATCCCGTGCAGTCAATCTGAA
>probe:Drosophila_2:1623788_at:21:495; Interrogation_Position=1777; Antisense; GTCAATCTGAATCTGCCAACTGCAC
>probe:Drosophila_2:1623788_at:263:225; Interrogation_Position=1822; Antisense; AAGGCACTCACTATTCAGGCATCTG
>probe:Drosophila_2:1623788_at:514:461; Interrogation_Position=1854; Antisense; GATTAAGAATCTACAGGCTGCCACA
>probe:Drosophila_2:1623788_at:290:271; Interrogation_Position=1877; Antisense; CATCCAGTCATCATAGGTCTCTCAA
>probe:Drosophila_2:1623788_at:488:57; Interrogation_Position=1901; Antisense; ATGAGAAGATTTCCACCATCGCCAA
>probe:Drosophila_2:1623788_at:177:575; Interrogation_Position=1942; Antisense; GGCGGTGTGACTACGACTGGAATCT
>probe:Drosophila_2:1623788_at:691:657; Interrogation_Position=2005; Antisense; TAAGCCCTTGATTGTTAACCTAGTA

Paste this into a BLAST search page for me
CACCTTAAGGAACTGCAGCGCGCATATTCAAGAATCCCTCGGCCAATTTGGATTTTCAAAGAGGCCTCCAGGCGGGGGTGAACTCTTGCCTTATGCCAAAACGGCCCATTGTATTGATCTTTTTGGCAATGGTTGTGACGCAATCGCGATGATCATCCCGTGCAGTCAATCTGAAGTCAATCTGAATCTGCCAACTGCACAAGGCACTCACTATTCAGGCATCTGGATTAAGAATCTACAGGCTGCCACACATCCAGTCATCATAGGTCTCTCAAATGAGAAGATTTCCACCATCGCCAAGGCGGTGTGACTACGACTGGAATCTTAAGCCCTTGATTGTTAACCTAGTA

Full Affymetrix probeset data:

Annotations for 1623788_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime