Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623789_at:

>probe:Drosophila_2:1623789_at:73:215; Interrogation_Position=1234; Antisense; AAGATGGCCAATGCTGGTCTGCTTT
>probe:Drosophila_2:1623789_at:195:621; Interrogation_Position=1281; Antisense; TGCTCTGGAGTGCAAGACCTTCGAT
>probe:Drosophila_2:1623789_at:521:151; Interrogation_Position=1310; Antisense; ACATGACCAAGGTGGCTCCGGATTT
>probe:Drosophila_2:1623789_at:297:539; Interrogation_Position=1343; Antisense; GGTACCTAGCATTGGATTCGCCTTT
>probe:Drosophila_2:1623789_at:175:171; Interrogation_Position=1388; Antisense; AAAGTGTGGCATTTCCTGGATTCTG
>probe:Drosophila_2:1623789_at:49:593; Interrogation_Position=1411; Antisense; TGTGTGGACTCCCTGAATTGTAGAC
>probe:Drosophila_2:1623789_at:327:485; Interrogation_Position=1430; Antisense; GTAGACACACTAAGCCCGTGGTTTT
>probe:Drosophila_2:1623789_at:222:345; Interrogation_Position=1470; Antisense; GCATAATTCAATGCCCGGCGAGCAT
>probe:Drosophila_2:1623789_at:570:575; Interrogation_Position=1486; Antisense; GGCGAGCATCAGAACTGGTCCTTAA
>probe:Drosophila_2:1623789_at:420:277; Interrogation_Position=1570; Antisense; CTACGCTCAAAGTCGGTGTGGCTCT
>probe:Drosophila_2:1623789_at:313:517; Interrogation_Position=1585; Antisense; GTGTGGCTCTTTCGTTGTCACAAAA
>probe:Drosophila_2:1623789_at:567:589; Interrogation_Position=1627; Antisense; TGGTACTACAATCACCGTCATCGGT
>probe:Drosophila_2:1623789_at:264:497; Interrogation_Position=1643; Antisense; GTCATCGGTGGATCCAACAGGGCCA
>probe:Drosophila_2:1623789_at:196:395; Interrogation_Position=1781; Antisense; GAAATGCGCCATATGATCCACAAAG

Paste this into a BLAST search page for me
AAGATGGCCAATGCTGGTCTGCTTTTGCTCTGGAGTGCAAGACCTTCGATACATGACCAAGGTGGCTCCGGATTTGGTACCTAGCATTGGATTCGCCTTTAAAGTGTGGCATTTCCTGGATTCTGTGTGTGGACTCCCTGAATTGTAGACGTAGACACACTAAGCCCGTGGTTTTGCATAATTCAATGCCCGGCGAGCATGGCGAGCATCAGAACTGGTCCTTAACTACGCTCAAAGTCGGTGTGGCTCTGTGTGGCTCTTTCGTTGTCACAAAATGGTACTACAATCACCGTCATCGGTGTCATCGGTGGATCCAACAGGGCCAGAAATGCGCCATATGATCCACAAAG

Full Affymetrix probeset data:

Annotations for 1623789_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime