FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623790_at:

>probe:Drosophila_2:1623790_at:21:115; Interrogation_Position=1413; Antisense; AGCAGCAGCTCATTGGGTTCCTCAA
>probe:Drosophila_2:1623790_at:236:541; Interrogation_Position=1428; Antisense; GGTTCCTCAACGACAGATTCTTCGA
>probe:Drosophila_2:1623790_at:216:689; Interrogation_Position=1456; Antisense; TTTCCTCCACCACAAATGCAGGTTC
>probe:Drosophila_2:1623790_at:318:231; Interrogation_Position=1470; Antisense; AATGCAGGTTCAACCGCCAGTTCTA
>probe:Drosophila_2:1623790_at:409:93; Interrogation_Position=1488; Antisense; AGTTCTACAACTTCTTCGCCATCCA
>probe:Drosophila_2:1623790_at:464:269; Interrogation_Position=1507; Antisense; CATCCATAAGCACTTCAACTTCTTC
>probe:Drosophila_2:1623790_at:480:251; Interrogation_Position=1544; Antisense; CAAGATTGCGGCCTGTTACAGCATC
>probe:Drosophila_2:1623790_at:134:223; Interrogation_Position=1602; Antisense; AAGGTGCCCGAGAAACATTCCGGCT
>probe:Drosophila_2:1623790_at:296:9; Interrogation_Position=1618; Antisense; ATTCCGGCTGCCAGGCTGTTCGAAA
>probe:Drosophila_2:1623790_at:685:375; Interrogation_Position=1659; Antisense; GAAGACTCTGCCGATCAGTGCGATA
>probe:Drosophila_2:1623790_at:637:265; Interrogation_Position=1674; Antisense; CAGTGCGATATCTGTTTGACGAATC
>probe:Drosophila_2:1623790_at:542:65; Interrogation_Position=1705; Antisense; ATGGAAGCACTAGCCTGAAGGTTTC
>probe:Drosophila_2:1623790_at:514:615; Interrogation_Position=1720; Antisense; TGAAGGTTTCACTTGGCGCCATGAT
>probe:Drosophila_2:1623790_at:480:57; Interrogation_Position=1740; Antisense; ATGATTCTTCTCTTGGCGATGGGAC

Paste this into a BLAST search page for me
AGCAGCAGCTCATTGGGTTCCTCAAGGTTCCTCAACGACAGATTCTTCGATTTCCTCCACCACAAATGCAGGTTCAATGCAGGTTCAACCGCCAGTTCTAAGTTCTACAACTTCTTCGCCATCCACATCCATAAGCACTTCAACTTCTTCCAAGATTGCGGCCTGTTACAGCATCAAGGTGCCCGAGAAACATTCCGGCTATTCCGGCTGCCAGGCTGTTCGAAAGAAGACTCTGCCGATCAGTGCGATACAGTGCGATATCTGTTTGACGAATCATGGAAGCACTAGCCTGAAGGTTTCTGAAGGTTTCACTTGGCGCCATGATATGATTCTTCTCTTGGCGATGGGAC

Full Affymetrix probeset data:

Annotations for 1623790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720