Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623791_s_at:

>probe:Drosophila_2:1623791_s_at:18:433; Interrogation_Position=148; Antisense; GAGTGCAGCGTGGAGTTTGCCGATT
>probe:Drosophila_2:1623791_s_at:135:437; Interrogation_Position=183; Antisense; GAGGATGCTGCAAGTCTGGGACACC
>probe:Drosophila_2:1623791_s_at:560:615; Interrogation_Position=191; Antisense; TGCAAGTCTGGGACACCTCCGACGA
>probe:Drosophila_2:1623791_s_at:80:87; Interrogation_Position=195; Antisense; AGTCTGGGACACCTCCGACGACGAG
>probe:Drosophila_2:1623791_s_at:346:29; Interrogation_Position=21; Antisense; ATACGACAATCCGTTTAAGATTATC
>probe:Drosophila_2:1623791_s_at:719:409; Interrogation_Position=211; Antisense; GACGACGAGCGCTTCAAATTGCTGA
>probe:Drosophila_2:1623791_s_at:412:343; Interrogation_Position=221; Antisense; GCTTCAAATTGCTGAAGGCGACCCA
>probe:Drosophila_2:1623791_s_at:640:191; Interrogation_Position=427; Antisense; AACTATGCCCATCGTCAGTCAATCT
>probe:Drosophila_2:1623791_s_at:625:307; Interrogation_Position=435; Antisense; CCATCGTCAGTCAATCTGCTTTGAA
>probe:Drosophila_2:1623791_s_at:170:267; Interrogation_Position=442; Antisense; CAGTCAATCTGCTTTGAAGAGGTTT
>probe:Drosophila_2:1623791_s_at:116:587; Interrogation_Position=515; Antisense; TGGACATATATACATATCGTCGTGT
>probe:Drosophila_2:1623791_s_at:645:251; Interrogation_Position=546; Antisense; CAACCCGTTCAGCTTGACATCTTGG
>probe:Drosophila_2:1623791_s_at:293:293; Interrogation_Position=551; Antisense; CGTTCAGCTTGACATCTTGGCAGGA
>probe:Drosophila_2:1623791_s_at:476:339; Interrogation_Position=557; Antisense; GCTTGACATCTTGGCAGGAAGAGGA

Paste this into a BLAST search page for me
GAGTGCAGCGTGGAGTTTGCCGATTGAGGATGCTGCAAGTCTGGGACACCTGCAAGTCTGGGACACCTCCGACGAAGTCTGGGACACCTCCGACGACGAGATACGACAATCCGTTTAAGATTATCGACGACGAGCGCTTCAAATTGCTGAGCTTCAAATTGCTGAAGGCGACCCAAACTATGCCCATCGTCAGTCAATCTCCATCGTCAGTCAATCTGCTTTGAACAGTCAATCTGCTTTGAAGAGGTTTTGGACATATATACATATCGTCGTGTCAACCCGTTCAGCTTGACATCTTGGCGTTCAGCTTGACATCTTGGCAGGAGCTTGACATCTTGGCAGGAAGAGGA

Full Affymetrix probeset data:

Annotations for 1623791_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime