Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623792_a_at:

>probe:Drosophila_2:1623792_a_at:134:279; Interrogation_Position=1044; Antisense; CTACGTCCAAATCTACACGGCTTTA
>probe:Drosophila_2:1623792_a_at:613:81; Interrogation_Position=1076; Antisense; AGGGACCCGCTCTTGTGGAAGACAT
>probe:Drosophila_2:1623792_a_at:365:605; Interrogation_Position=1121; Antisense; TGATCACACGGCTGGGTCACACTAA
>probe:Drosophila_2:1623792_a_at:134:595; Interrogation_Position=1160; Antisense; TGGGCACCAACAGCAAGTTCTACTT
>probe:Drosophila_2:1623792_a_at:188:271; Interrogation_Position=1267; Antisense; CATGCTTTTCCTTTGGTCTAACCAA
>probe:Drosophila_2:1623792_a_at:623:369; Interrogation_Position=729; Antisense; GAATGTGCCTATACTCTTGAAACTT
>probe:Drosophila_2:1623792_a_at:12:319; Interrogation_Position=756; Antisense; GCCGGATCTATCTTTGGACGACATG
>probe:Drosophila_2:1623792_a_at:716:519; Interrogation_Position=820; Antisense; GTGGATGGCCTGATCGTTTCAAACA
>probe:Drosophila_2:1623792_a_at:634:149; Interrogation_Position=842; Antisense; ACACCACGGTGTCGCGGGAAAACAT
>probe:Drosophila_2:1623792_a_at:132:143; Interrogation_Position=892; Antisense; ACTGGCGGATTAAGTGGTCCTCCAC
>probe:Drosophila_2:1623792_a_at:37:427; Interrogation_Position=934; Antisense; GAGATGATCGCCCAGATGTACCAGC
>probe:Drosophila_2:1623792_a_at:593:99; Interrogation_Position=947; Antisense; AGATGTACCAGCTCACCGATGGAAA
>probe:Drosophila_2:1623792_a_at:270:393; Interrogation_Position=968; Antisense; GAAAGATTCCCATCATAGGCGTCGG
>probe:Drosophila_2:1623792_a_at:302:83; Interrogation_Position=996; Antisense; AGTGGCTTCCGGCTATGATGCATAC

Paste this into a BLAST search page for me
CTACGTCCAAATCTACACGGCTTTAAGGGACCCGCTCTTGTGGAAGACATTGATCACACGGCTGGGTCACACTAATGGGCACCAACAGCAAGTTCTACTTCATGCTTTTCCTTTGGTCTAACCAAGAATGTGCCTATACTCTTGAAACTTGCCGGATCTATCTTTGGACGACATGGTGGATGGCCTGATCGTTTCAAACAACACCACGGTGTCGCGGGAAAACATACTGGCGGATTAAGTGGTCCTCCACGAGATGATCGCCCAGATGTACCAGCAGATGTACCAGCTCACCGATGGAAAGAAAGATTCCCATCATAGGCGTCGGAGTGGCTTCCGGCTATGATGCATAC

Full Affymetrix probeset data:

Annotations for 1623792_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime