FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623793_at:

>probe:Drosophila_2:1623793_at:671:699; Interrogation_Position=1940; Antisense; TTTTTTATTAAATGCCCTCTCCCAT
>probe:Drosophila_2:1623793_at:635:233; Interrogation_Position=1950; Antisense; AATGCCCTCTCCCATTATAAAAACG
>probe:Drosophila_2:1623793_at:144:59; Interrogation_Position=2005; Antisense; ATGATCTTTTTATTATGCCTCTTCT
>probe:Drosophila_2:1623793_at:526:49; Interrogation_Position=2019; Antisense; ATGCCTCTTCTTTTTGGGACATTGT
>probe:Drosophila_2:1623793_at:604:729; Interrogation_Position=2032; Antisense; TTGGGACATTGTTATTGCTTTGCAA
>probe:Drosophila_2:1623793_at:624:343; Interrogation_Position=2058; Antisense; GCATTGATAATTTGTTCGCAACTAA
>probe:Drosophila_2:1623793_at:682:59; Interrogation_Position=2121; Antisense; ATGTTTCTAGATTTCTTTTCTGCAA
>probe:Drosophila_2:1623793_at:409:569; Interrogation_Position=2168; Antisense; GGCTTGAGGTTTGGATGTTGTTTTA
>probe:Drosophila_2:1623793_at:509:681; Interrogation_Position=2265; Antisense; TATCCATACCCATACCTTGAAACAA
>probe:Drosophila_2:1623793_at:71:21; Interrogation_Position=2299; Antisense; ATTTGTCATTAAAGTCGTGCATGCA
>probe:Drosophila_2:1623793_at:320:103; Interrogation_Position=2395; Antisense; AGACGGCATTCTTGATTCATTACAA
>probe:Drosophila_2:1623793_at:603:677; Interrogation_Position=2422; Antisense; TTTGTAACCCTAGAAGCGAGTCCGA
>probe:Drosophila_2:1623793_at:480:323; Interrogation_Position=2437; Antisense; GCGAGTCCGACCCTATAAGGTACAT
>probe:Drosophila_2:1623793_at:592:77; Interrogation_Position=2474; Antisense; AGGATACCCAACCAAGTCGATCTGA

Paste this into a BLAST search page for me
TTTTTTATTAAATGCCCTCTCCCATAATGCCCTCTCCCATTATAAAAACGATGATCTTTTTATTATGCCTCTTCTATGCCTCTTCTTTTTGGGACATTGTTTGGGACATTGTTATTGCTTTGCAAGCATTGATAATTTGTTCGCAACTAAATGTTTCTAGATTTCTTTTCTGCAAGGCTTGAGGTTTGGATGTTGTTTTATATCCATACCCATACCTTGAAACAAATTTGTCATTAAAGTCGTGCATGCAAGACGGCATTCTTGATTCATTACAATTTGTAACCCTAGAAGCGAGTCCGAGCGAGTCCGACCCTATAAGGTACATAGGATACCCAACCAAGTCGATCTGA

Full Affymetrix probeset data:

Annotations for 1623793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720