FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623794_at:

>probe:Drosophila_2:1623794_at:29:299; Interrogation_Position=1270; Antisense; CGCTTCTCCCAGATGTACAACATGA
>probe:Drosophila_2:1623794_at:70:153; Interrogation_Position=1289; Antisense; ACATGAAGGCCCATCTGCGGGAGCA
>probe:Drosophila_2:1623794_at:357:553; Interrogation_Position=1308; Antisense; GGAGCACGAGAGTCCCGGAACCAAC
>probe:Drosophila_2:1623794_at:94:617; Interrogation_Position=1360; Antisense; TGCACGCATACTTTCATCAACGAGC
>probe:Drosophila_2:1623794_at:226:193; Interrogation_Position=1387; Antisense; AACTATGATGCCCACGTTCAGAGAG
>probe:Drosophila_2:1623794_at:409:101; Interrogation_Position=1406; Antisense; AGAGAGACGACTGCACGCCAGTTTA
>probe:Drosophila_2:1623794_at:33:315; Interrogation_Position=1422; Antisense; GCCAGTTTAGCCCACTATATTGAAT
>probe:Drosophila_2:1623794_at:691:687; Interrogation_Position=1465; Antisense; TATATTGTGTAAGGCCCAACCCATC
>probe:Drosophila_2:1623794_at:32:453; Interrogation_Position=1541; Antisense; GATCATTACGTTCTATCCATGTACT
>probe:Drosophila_2:1623794_at:217:705; Interrogation_Position=1624; Antisense; TTATCCGTTACTTGCATATTTCTGC
>probe:Drosophila_2:1623794_at:17:165; Interrogation_Position=1716; Antisense; AAATCAATCGATCGACCTCGTCCGT
>probe:Drosophila_2:1623794_at:55:133; Interrogation_Position=1763; Antisense; ACCCACCCATTGTATTCCAGTATTG
>probe:Drosophila_2:1623794_at:288:265; Interrogation_Position=1780; Antisense; CAGTATTGGTCGCTGCTGGACTGAT
>probe:Drosophila_2:1623794_at:294:333; Interrogation_Position=1794; Antisense; GCTGGACTGATCGAGCCCCAAATGA

Paste this into a BLAST search page for me
CGCTTCTCCCAGATGTACAACATGAACATGAAGGCCCATCTGCGGGAGCAGGAGCACGAGAGTCCCGGAACCAACTGCACGCATACTTTCATCAACGAGCAACTATGATGCCCACGTTCAGAGAGAGAGAGACGACTGCACGCCAGTTTAGCCAGTTTAGCCCACTATATTGAATTATATTGTGTAAGGCCCAACCCATCGATCATTACGTTCTATCCATGTACTTTATCCGTTACTTGCATATTTCTGCAAATCAATCGATCGACCTCGTCCGTACCCACCCATTGTATTCCAGTATTGCAGTATTGGTCGCTGCTGGACTGATGCTGGACTGATCGAGCCCCAAATGA

Full Affymetrix probeset data:

Annotations for 1623794_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720