Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623795_at:

>probe:Drosophila_2:1623795_at:604:551; Interrogation_Position=1009; Antisense; GGAGCTAGCAGAGGTGTTTCCTTCA
>probe:Drosophila_2:1623795_at:315:247; Interrogation_Position=1041; Antisense; AATTCGAAGCCAGTCATGCGGATCT
>probe:Drosophila_2:1623795_at:267:403; Interrogation_Position=1102; Antisense; GACTATGCGTTTAATACCGGCCGTT
>probe:Drosophila_2:1623795_at:635:129; Interrogation_Position=1117; Antisense; ACCGGCCGTTCCATTACTGATAAGG
>probe:Drosophila_2:1623795_at:553:657; Interrogation_Position=1137; Antisense; TAAGGCAAACTTCCCATTCTATTCA
>probe:Drosophila_2:1623795_at:393:677; Interrogation_Position=1206; Antisense; TAGACATTTTTCACACTCATCGTAA
>probe:Drosophila_2:1623795_at:293:529; Interrogation_Position=1243; Antisense; GGGACCACAGGCTAATGCATTTAAT
>probe:Drosophila_2:1623795_at:545:655; Interrogation_Position=1264; Antisense; TAATCCCGATAACTTTCTGCCTGAA
>probe:Drosophila_2:1623795_at:361:109; Interrogation_Position=1297; Antisense; AGCAAGGCCACCTTATTCCTATTTA
>probe:Drosophila_2:1623795_at:239:561; Interrogation_Position=1356; Antisense; GGAAACTCTCGCTGATATCTGCAAA
>probe:Drosophila_2:1623795_at:117:687; Interrogation_Position=1409; Antisense; TATATGCTGAGTACCACCTTTTTGT
>probe:Drosophila_2:1623795_at:222:379; Interrogation_Position=1468; Antisense; GAAGCTGGCTGAGCAACCATTACTA
>probe:Drosophila_2:1623795_at:669:21; Interrogation_Position=917; Antisense; ATATTTGCCGCATCCGATACTTTAT
>probe:Drosophila_2:1623795_at:214:705; Interrogation_Position=963; Antisense; TTATCCTGATGGCAATGTTTCCTAA

Paste this into a BLAST search page for me
GGAGCTAGCAGAGGTGTTTCCTTCAAATTCGAAGCCAGTCATGCGGATCTGACTATGCGTTTAATACCGGCCGTTACCGGCCGTTCCATTACTGATAAGGTAAGGCAAACTTCCCATTCTATTCATAGACATTTTTCACACTCATCGTAAGGGACCACAGGCTAATGCATTTAATTAATCCCGATAACTTTCTGCCTGAAAGCAAGGCCACCTTATTCCTATTTAGGAAACTCTCGCTGATATCTGCAAATATATGCTGAGTACCACCTTTTTGTGAAGCTGGCTGAGCAACCATTACTAATATTTGCCGCATCCGATACTTTATTTATCCTGATGGCAATGTTTCCTAA

Full Affymetrix probeset data:

Annotations for 1623795_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime