Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623796_at:

>probe:Drosophila_2:1623796_at:337:647; Interrogation_Position=118; Antisense; TCAGATTTTCCTGGACAAGGTGCGC
>probe:Drosophila_2:1623796_at:178:161; Interrogation_Position=132; Antisense; ACAAGGTGCGCGAGTATCGGCTGAA
>probe:Drosophila_2:1623796_at:466:483; Interrogation_Position=145; Antisense; GTATCGGCTGAAGAGTCCCAAGGGA
>probe:Drosophila_2:1623796_at:418:199; Interrogation_Position=170; Antisense; AAGCCCGTAGATCCTGGTCCGGAAT
>probe:Drosophila_2:1623796_at:544:371; Interrogation_Position=208; Antisense; GAAGGAAGTCACTGAGCGCCTGGCT
>probe:Drosophila_2:1623796_at:585:327; Interrogation_Position=255; Antisense; GCGTGGATATGCTCGAGTTTCCGAA
>probe:Drosophila_2:1623796_at:349:475; Interrogation_Position=271; Antisense; GTTTCCGAAATTCAAGTTGCCCGAT
>probe:Drosophila_2:1623796_at:729:469; Interrogation_Position=286; Antisense; GTTGCCCGATATTGATATTGATCCC
>probe:Drosophila_2:1623796_at:431:459; Interrogation_Position=299; Antisense; GATATTGATCCCATTTCGGTTGATG
>probe:Drosophila_2:1623796_at:2:715; Interrogation_Position=313; Antisense; TTCGGTTGATGATCTACCAGAGAAC
>probe:Drosophila_2:1623796_at:509:101; Interrogation_Position=331; Antisense; AGAGAACCAACCAAAGCCTGAGAAA
>probe:Drosophila_2:1623796_at:14:107; Interrogation_Position=426; Antisense; AGAAAGCTGACGAACCAAAGGGCAA
>probe:Drosophila_2:1623796_at:487:433; Interrogation_Position=73; Antisense; GAGTGTGAGCAATACCGCATCCCTT
>probe:Drosophila_2:1623796_at:690:273; Interrogation_Position=95; Antisense; CTTCGCTACAAGGATCCCATTTATC

Paste this into a BLAST search page for me
TCAGATTTTCCTGGACAAGGTGCGCACAAGGTGCGCGAGTATCGGCTGAAGTATCGGCTGAAGAGTCCCAAGGGAAAGCCCGTAGATCCTGGTCCGGAATGAAGGAAGTCACTGAGCGCCTGGCTGCGTGGATATGCTCGAGTTTCCGAAGTTTCCGAAATTCAAGTTGCCCGATGTTGCCCGATATTGATATTGATCCCGATATTGATCCCATTTCGGTTGATGTTCGGTTGATGATCTACCAGAGAACAGAGAACCAACCAAAGCCTGAGAAAAGAAAGCTGACGAACCAAAGGGCAAGAGTGTGAGCAATACCGCATCCCTTCTTCGCTACAAGGATCCCATTTATC

Full Affymetrix probeset data:

Annotations for 1623796_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime