FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623797_at:

>probe:Drosophila_2:1623797_at:496:723; Interrogation_Position=349; Antisense; TTGCATTGCACATCGCCCTGGGACT
>probe:Drosophila_2:1623797_at:71:45; Interrogation_Position=360; Antisense; ATCGCCCTGGGACTCTATATATACA
>probe:Drosophila_2:1623797_at:112:405; Interrogation_Position=370; Antisense; GACTCTATATATACAGGGCCTACTT
>probe:Drosophila_2:1623797_at:600:571; Interrogation_Position=414; Antisense; GGCTCCAAAACGGACTAATCCTCAT
>probe:Drosophila_2:1623797_at:322:201; Interrogation_Position=430; Antisense; AATCCTCATCTACCCCGGACTGTTA
>probe:Drosophila_2:1623797_at:446:401; Interrogation_Position=447; Antisense; GACTGTTACCCTATTTCCATTAACT
>probe:Drosophila_2:1623797_at:316:191; Interrogation_Position=468; Antisense; AACTTTAAGTCGGTAGAGCACTCTT
>probe:Drosophila_2:1623797_at:364:539; Interrogation_Position=479; Antisense; GGTAGAGCACTCTTGTACATACATA
>probe:Drosophila_2:1623797_at:451:249; Interrogation_Position=523; Antisense; CAATTGTTTACATGCCAGCGAGGGA
>probe:Drosophila_2:1623797_at:560:393; Interrogation_Position=551; Antisense; GAAAGTCGCCTGTAAACCGTGTGTA
>probe:Drosophila_2:1623797_at:127:131; Interrogation_Position=566; Antisense; ACCGTGTGTAATCGCTTTTCATTGC
>probe:Drosophila_2:1623797_at:443:343; Interrogation_Position=589; Antisense; GCATAAGTTTCGATAACAGCGTGGA
>probe:Drosophila_2:1623797_at:305:687; Interrogation_Position=817; Antisense; TATTTGTACTCTCTGCTTGAAAGGG
>probe:Drosophila_2:1623797_at:117:59; Interrogation_Position=922; Antisense; ATGTTTTCTTTTTGATTGAAGCACA

Paste this into a BLAST search page for me
TTGCATTGCACATCGCCCTGGGACTATCGCCCTGGGACTCTATATATACAGACTCTATATATACAGGGCCTACTTGGCTCCAAAACGGACTAATCCTCATAATCCTCATCTACCCCGGACTGTTAGACTGTTACCCTATTTCCATTAACTAACTTTAAGTCGGTAGAGCACTCTTGGTAGAGCACTCTTGTACATACATACAATTGTTTACATGCCAGCGAGGGAGAAAGTCGCCTGTAAACCGTGTGTAACCGTGTGTAATCGCTTTTCATTGCGCATAAGTTTCGATAACAGCGTGGATATTTGTACTCTCTGCTTGAAAGGGATGTTTTCTTTTTGATTGAAGCACA

Full Affymetrix probeset data:

Annotations for 1623797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720