Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623798_at:

>probe:Drosophila_2:1623798_at:268:583; Interrogation_Position=2918; Antisense; TGGCGGCCACGGTTGCAGGCTCAAC
>probe:Drosophila_2:1623798_at:368:469; Interrogation_Position=2929; Antisense; GTTGCAGGCTCAACTGTGACGCCGG
>probe:Drosophila_2:1623798_at:195:451; Interrogation_Position=2964; Antisense; GATCGTTCAGCTGCCGACTGTGGAG
>probe:Drosophila_2:1623798_at:715:407; Interrogation_Position=3118; Antisense; GACGAGGATCCAGAACTAGACAGTG
>probe:Drosophila_2:1623798_at:329:247; Interrogation_Position=3162; Antisense; AATTGCGGTCAGTGAGCCTGGCGAC
>probe:Drosophila_2:1623798_at:136:513; Interrogation_Position=3173; Antisense; GTGAGCCTGGCGACAATTCGTCCAA
>probe:Drosophila_2:1623798_at:239:397; Interrogation_Position=3184; Antisense; GACAATTCGTCCAACTAGCATTCGG
>probe:Drosophila_2:1623798_at:143:117; Interrogation_Position=3200; Antisense; AGCATTCGGAGTCGCTGTTCATGGA
>probe:Drosophila_2:1623798_at:639:385; Interrogation_Position=3223; Antisense; GAACAGTTCTTGTTTGACCACTTCC
>probe:Drosophila_2:1623798_at:251:529; Interrogation_Position=3280; Antisense; GGGACCATGGTTTAGCAATATATAA
>probe:Drosophila_2:1623798_at:68:167; Interrogation_Position=3342; Antisense; AAATGTTTACCCTTCTTGTACAGCT
>probe:Drosophila_2:1623798_at:301:713; Interrogation_Position=3354; Antisense; TTCTTGTACAGCTCCGGTTGCGGAT
>probe:Drosophila_2:1623798_at:292:623; Interrogation_Position=3372; Antisense; TGCGGATCATCCTAGATTAGTGTAC
>probe:Drosophila_2:1623798_at:688:513; Interrogation_Position=3391; Antisense; GTGTACATAGCTTAATCGACCATCG

Paste this into a BLAST search page for me
TGGCGGCCACGGTTGCAGGCTCAACGTTGCAGGCTCAACTGTGACGCCGGGATCGTTCAGCTGCCGACTGTGGAGGACGAGGATCCAGAACTAGACAGTGAATTGCGGTCAGTGAGCCTGGCGACGTGAGCCTGGCGACAATTCGTCCAAGACAATTCGTCCAACTAGCATTCGGAGCATTCGGAGTCGCTGTTCATGGAGAACAGTTCTTGTTTGACCACTTCCGGGACCATGGTTTAGCAATATATAAAAATGTTTACCCTTCTTGTACAGCTTTCTTGTACAGCTCCGGTTGCGGATTGCGGATCATCCTAGATTAGTGTACGTGTACATAGCTTAATCGACCATCG

Full Affymetrix probeset data:

Annotations for 1623798_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime