FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623802_at:

>probe:Drosophila_2:1623802_at:564:291; Interrogation_Position=2893; Antisense; CGTCAGCTAGACGAACTGGTGGTGC
>probe:Drosophila_2:1623802_at:50:341; Interrogation_Position=2958; Antisense; GCTAAAGATGAATCGCCTCAAGGAG
>probe:Drosophila_2:1623802_at:181:543; Interrogation_Position=2994; Antisense; GGATTTAGTTCTGGCCGAGAGCGTC
>probe:Drosophila_2:1623802_at:76:189; Interrogation_Position=3088; Antisense; AACAGCCAGGCGGAGGTGAAACAGC
>probe:Drosophila_2:1623802_at:708:61; Interrogation_Position=3142; Antisense; ATGTGCGGCGACATCATCATGGAGC
>probe:Drosophila_2:1623802_at:292:103; Interrogation_Position=3172; Antisense; AGACTGCGCGACAACCTTAACGCGG
>probe:Drosophila_2:1623802_at:202:659; Interrogation_Position=3189; Antisense; TAACGCGGACATCCAGAGCGAGCTG
>probe:Drosophila_2:1623802_at:579:549; Interrogation_Position=3214; Antisense; GGAGTGCTAAACGAGCGCCACAAGC
>probe:Drosophila_2:1623802_at:216:545; Interrogation_Position=3246; Antisense; GGATCAGCTTCAGAAGCGCGTCCAC
>probe:Drosophila_2:1623802_at:443:129; Interrogation_Position=3269; Antisense; ACCAGACCATTCAGCGGCAGGAGGA
>probe:Drosophila_2:1623802_at:9:425; Interrogation_Position=3292; Antisense; GAGACCATTGAGATCCTGAAGGGCG
>probe:Drosophila_2:1623802_at:709:49; Interrogation_Position=3323; Antisense; ATGCCCTCAGGCAGCAGTGTCTGAA
>probe:Drosophila_2:1623802_at:294:515; Interrogation_Position=3339; Antisense; GTGTCTGAAGCTCAACGCTGTCATA
>probe:Drosophila_2:1623802_at:649:531; Interrogation_Position=3413; Antisense; GGTGTATGGGACCTCCAAGCTAAAT

Paste this into a BLAST search page for me
CGTCAGCTAGACGAACTGGTGGTGCGCTAAAGATGAATCGCCTCAAGGAGGGATTTAGTTCTGGCCGAGAGCGTCAACAGCCAGGCGGAGGTGAAACAGCATGTGCGGCGACATCATCATGGAGCAGACTGCGCGACAACCTTAACGCGGTAACGCGGACATCCAGAGCGAGCTGGGAGTGCTAAACGAGCGCCACAAGCGGATCAGCTTCAGAAGCGCGTCCACACCAGACCATTCAGCGGCAGGAGGAGAGACCATTGAGATCCTGAAGGGCGATGCCCTCAGGCAGCAGTGTCTGAAGTGTCTGAAGCTCAACGCTGTCATAGGTGTATGGGACCTCCAAGCTAAAT

Full Affymetrix probeset data:

Annotations for 1623802_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720