FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623805_at:

>probe:Drosophila_2:1623805_at:612:587; Interrogation_Position=516; Antisense; TGGAGTTACTCCTGCGAATGTCGCT
>probe:Drosophila_2:1623805_at:297:229; Interrogation_Position=532; Antisense; AATGTCGCTACTCCTTCAAGTGAAG
>probe:Drosophila_2:1623805_at:192:221; Interrogation_Position=549; Antisense; AAGTGAAGCCACTACTACTACTCCA
>probe:Drosophila_2:1623805_at:318:125; Interrogation_Position=586; Antisense; AGCCCAGTGGAAACATCGTCTTCAG
>probe:Drosophila_2:1623805_at:565:167; Interrogation_Position=630; Antisense; AAATGAAGCCACTACAGCGCCTGCA
>probe:Drosophila_2:1623805_at:202:197; Interrogation_Position=654; Antisense; AACGGATGCACCCACTTCAATGGAA
>probe:Drosophila_2:1623805_at:578:387; Interrogation_Position=706; Antisense; GAAAACCTCGGGTAGCAGCCGCCAA
>probe:Drosophila_2:1623805_at:266:309; Interrogation_Position=726; Antisense; GCCAAAATAACCCATCCGCTTATTA
>probe:Drosophila_2:1623805_at:663:705; Interrogation_Position=818; Antisense; TTATGTTCGCTTCTGATCGCCCAAA
>probe:Drosophila_2:1623805_at:395:641; Interrogation_Position=867; Antisense; TCGGCCCATTTTTCGGGTATGACAT
>probe:Drosophila_2:1623805_at:181:647; Interrogation_Position=900; Antisense; TCATCCTTGACGTCACCCTGAATGA
>probe:Drosophila_2:1623805_at:619:53; Interrogation_Position=921; Antisense; ATGACGATCTCGTCGTCTCCGGTAA
>probe:Drosophila_2:1623805_at:642:415; Interrogation_Position=951; Antisense; GAGCCGCAGGCAAATTTCGTGCCAA
>probe:Drosophila_2:1623805_at:63:575; Interrogation_Position=983; Antisense; GGCGGCCACCTTGAGATCAATATCT

Paste this into a BLAST search page for me
TGGAGTTACTCCTGCGAATGTCGCTAATGTCGCTACTCCTTCAAGTGAAGAAGTGAAGCCACTACTACTACTCCAAGCCCAGTGGAAACATCGTCTTCAGAAATGAAGCCACTACAGCGCCTGCAAACGGATGCACCCACTTCAATGGAAGAAAACCTCGGGTAGCAGCCGCCAAGCCAAAATAACCCATCCGCTTATTATTATGTTCGCTTCTGATCGCCCAAATCGGCCCATTTTTCGGGTATGACATTCATCCTTGACGTCACCCTGAATGAATGACGATCTCGTCGTCTCCGGTAAGAGCCGCAGGCAAATTTCGTGCCAAGGCGGCCACCTTGAGATCAATATCT

Full Affymetrix probeset data:

Annotations for 1623805_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720