FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623806_at:

>probe:Drosophila_2:1623806_at:152:95; Interrogation_Position=1562; Antisense; AAATGCAAAACGAGGCCGCCGGCGG
>probe:Drosophila_2:1623806_at:605:79; Interrogation_Position=1598; Antisense; AGGTGCCCAGCATGAGCCTGAAATT
>probe:Drosophila_2:1623806_at:254:285; Interrogation_Position=1615; Antisense; CTGAAATTGCGCACCCAGCTGGAGG
>probe:Drosophila_2:1623806_at:262:561; Interrogation_Position=1638; Antisense; GGAACTAAAACATCTGCCACAGCCG
>probe:Drosophila_2:1623806_at:459:109; Interrogation_Position=1706; Antisense; AGAAGCATAATATTACGCCCACCAC
>probe:Drosophila_2:1623806_at:196:671; Interrogation_Position=1732; Antisense; TACCTCTCGGTTAAGACTGTCTGCT
>probe:Drosophila_2:1623806_at:531:143; Interrogation_Position=1747; Antisense; ACTGTCTGCTTGAGCGGAGCACCAT
>probe:Drosophila_2:1623806_at:297:419; Interrogation_Position=1763; Antisense; GAGCACCATCGTTGGGTAGTCCTAT
>probe:Drosophila_2:1623806_at:348:467; Interrogation_Position=1778; Antisense; GTAGTCCTATGGAGACTTCGCTGCG
>probe:Drosophila_2:1623806_at:691:275; Interrogation_Position=1793; Antisense; CTTCGCTGCGCAAGTTCTTTATCAA
>probe:Drosophila_2:1623806_at:566:93; Interrogation_Position=1805; Antisense; AGTTCTTTATCAAGTGCGGCTGGCT
>probe:Drosophila_2:1623806_at:409:573; Interrogation_Position=1826; Antisense; GGCTGAGCCACTGAACATCTTCCAA
>probe:Drosophila_2:1623806_at:346:415; Interrogation_Position=1873; Antisense; GAGCCACATGCATTTCCAAGGACTT
>probe:Drosophila_2:1623806_at:70:195; Interrogation_Position=1950; Antisense; AACTGTCGTTGGCATTTTCATCAAG

Paste this into a BLAST search page for me
AAATGCAAAACGAGGCCGCCGGCGGAGGTGCCCAGCATGAGCCTGAAATTCTGAAATTGCGCACCCAGCTGGAGGGGAACTAAAACATCTGCCACAGCCGAGAAGCATAATATTACGCCCACCACTACCTCTCGGTTAAGACTGTCTGCTACTGTCTGCTTGAGCGGAGCACCATGAGCACCATCGTTGGGTAGTCCTATGTAGTCCTATGGAGACTTCGCTGCGCTTCGCTGCGCAAGTTCTTTATCAAAGTTCTTTATCAAGTGCGGCTGGCTGGCTGAGCCACTGAACATCTTCCAAGAGCCACATGCATTTCCAAGGACTTAACTGTCGTTGGCATTTTCATCAAG

Full Affymetrix probeset data:

Annotations for 1623806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720