Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623811_at:

>probe:Drosophila_2:1623811_at:182:67; Interrogation_Position=220; Antisense; AGGAATTAACAACCCCGCAAGCCAG
>probe:Drosophila_2:1623811_at:64:15; Interrogation_Position=287; Antisense; ATTACGCATTGCCTACAAGCCGGTA
>probe:Drosophila_2:1623811_at:75:319; Interrogation_Position=305; Antisense; GCCGGTAGGCTATCATCTGGAGAAA
>probe:Drosophila_2:1623811_at:612:583; Interrogation_Position=322; Antisense; TGGAGAAACCAGGTCGTTCCTACTG
>probe:Drosophila_2:1623811_at:559:469; Interrogation_Position=337; Antisense; GTTCCTACTGGCACACTTTGGAAAT
>probe:Drosophila_2:1623811_at:395:687; Interrogation_Position=353; Antisense; TTTGGAAATCAACACCAGCGGCCGC
>probe:Drosophila_2:1623811_at:457:61; Interrogation_Position=379; Antisense; ATGTCAGCGGCGATGTCAAGCACTT
>probe:Drosophila_2:1623811_at:344:229; Interrogation_Position=408; Antisense; AATGGAACCATCCTGAGTGCCAGCA
>probe:Drosophila_2:1623811_at:421:263; Interrogation_Position=428; Antisense; CAGCACCTCGGAATGGGCCATTAAA
>probe:Drosophila_2:1623811_at:256:399; Interrogation_Position=474; Antisense; GACACATCTGCGTTTGTAAATCTCG
>probe:Drosophila_2:1623811_at:545:491; Interrogation_Position=489; Antisense; GTAAATCTCGGCAGAGTGCTCGCAC
>probe:Drosophila_2:1623811_at:593:281; Interrogation_Position=518; Antisense; CTGCCTGCAGTCTGGGATCACGGAA
>probe:Drosophila_2:1623811_at:690:55; Interrogation_Position=543; Antisense; ATGACCTGCAACGTGGAGGCGGTAC
>probe:Drosophila_2:1623811_at:196:375; Interrogation_Position=696; Antisense; GAAGACGCACTGGAAGCACCCAAAT

Paste this into a BLAST search page for me
AGGAATTAACAACCCCGCAAGCCAGATTACGCATTGCCTACAAGCCGGTAGCCGGTAGGCTATCATCTGGAGAAATGGAGAAACCAGGTCGTTCCTACTGGTTCCTACTGGCACACTTTGGAAATTTTGGAAATCAACACCAGCGGCCGCATGTCAGCGGCGATGTCAAGCACTTAATGGAACCATCCTGAGTGCCAGCACAGCACCTCGGAATGGGCCATTAAAGACACATCTGCGTTTGTAAATCTCGGTAAATCTCGGCAGAGTGCTCGCACCTGCCTGCAGTCTGGGATCACGGAAATGACCTGCAACGTGGAGGCGGTACGAAGACGCACTGGAAGCACCCAAAT

Full Affymetrix probeset data:

Annotations for 1623811_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime