Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623812_at:

>probe:Drosophila_2:1623812_at:228:709; Interrogation_Position=340; Antisense; TTACTTATTTCTTCCCTCGAAGCGC
>probe:Drosophila_2:1623812_at:403:645; Interrogation_Position=349; Antisense; TCTTCCCTCGAAGCGCAGATTAAAG
>probe:Drosophila_2:1623812_at:695:167; Interrogation_Position=420; Antisense; AAAGTCTCAGATAGGCGACAATGAT
>probe:Drosophila_2:1623812_at:51:187; Interrogation_Position=461; Antisense; AACAAGATCTTATAGCAACACTCGA
>probe:Drosophila_2:1623812_at:637:357; Interrogation_Position=475; Antisense; GCAACACTCGAAGCTCGTTTGAAAG
>probe:Drosophila_2:1623812_at:115:683; Interrogation_Position=531; Antisense; TATGATCCAATCTCTAAGCGTTAAA
>probe:Drosophila_2:1623812_at:29:31; Interrogation_Position=587; Antisense; ATAAATCTCTTATAGCAACCCTCAA
>probe:Drosophila_2:1623812_at:613:25; Interrogation_Position=598; Antisense; ATAGCAACCCTCAAAAATCAGATAG
>probe:Drosophila_2:1623812_at:14:525; Interrogation_Position=655; Antisense; GGGATAATAACTTCACTCAAGGCTC
>probe:Drosophila_2:1623812_at:574:29; Interrogation_Position=766; Antisense; ATCACATATTTGGAATTGGGTCTAA
>probe:Drosophila_2:1623812_at:314:689; Interrogation_Position=827; Antisense; TATTAAACGATCAAGCTGCTACCAT
>probe:Drosophila_2:1623812_at:36:341; Interrogation_Position=844; Antisense; GCTACCATAATGAAACTGCAATCTA
>probe:Drosophila_2:1623812_at:680:177; Interrogation_Position=895; Antisense; AAACTTATACCATCAGAGGGTCAAC
>probe:Drosophila_2:1623812_at:92:433; Interrogation_Position=910; Antisense; GAGGGTCAACAAATTTCCAACGCTT

Paste this into a BLAST search page for me
TTACTTATTTCTTCCCTCGAAGCGCTCTTCCCTCGAAGCGCAGATTAAAGAAAGTCTCAGATAGGCGACAATGATAACAAGATCTTATAGCAACACTCGAGCAACACTCGAAGCTCGTTTGAAAGTATGATCCAATCTCTAAGCGTTAAAATAAATCTCTTATAGCAACCCTCAAATAGCAACCCTCAAAAATCAGATAGGGGATAATAACTTCACTCAAGGCTCATCACATATTTGGAATTGGGTCTAATATTAAACGATCAAGCTGCTACCATGCTACCATAATGAAACTGCAATCTAAAACTTATACCATCAGAGGGTCAACGAGGGTCAACAAATTTCCAACGCTT

Full Affymetrix probeset data:

Annotations for 1623812_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime