Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623813_at:

>probe:Drosophila_2:1623813_at:634:225; Interrogation_Position=1043; Antisense; AAGGACTCTCCACTGCTGATTAATC
>probe:Drosophila_2:1623813_at:697:153; Interrogation_Position=1079; Antisense; ACAGGACTCACCGACTTGCAATATA
>probe:Drosophila_2:1623813_at:114:363; Interrogation_Position=1096; Antisense; GCAATATAAGACACTCCTGACCGGC
>probe:Drosophila_2:1623813_at:348:23; Interrogation_Position=1136; Antisense; ATATCCACCAAGTTCGTGAGCGATG
>probe:Drosophila_2:1623813_at:545:63; Interrogation_Position=1158; Antisense; ATGTGGCCGATTACTTCTGGGAAAT
>probe:Drosophila_2:1623813_at:700:717; Interrogation_Position=738; Antisense; TTCCTTTACTTTTAGTAGCCCAGCT
>probe:Drosophila_2:1623813_at:113:243; Interrogation_Position=766; Antisense; AATAGTGGCTGCCAAGCCCACAAAT
>probe:Drosophila_2:1623813_at:576:193; Interrogation_Position=795; Antisense; AACTCCTAAACTCCGATGATCCAGT
>probe:Drosophila_2:1623813_at:108:77; Interrogation_Position=846; Antisense; AGGAGGAGACAGTCCACCTGCTGAA
>probe:Drosophila_2:1623813_at:436:335; Interrogation_Position=865; Antisense; GCTGAACTCGTTGTTCCGATCACAA
>probe:Drosophila_2:1623813_at:39:167; Interrogation_Position=888; Antisense; AAATCGCCTATTTCTCCGAGGTGAA
>probe:Drosophila_2:1623813_at:171:79; Interrogation_Position=906; Antisense; AGGTGAAGGCCGCTCTGAATCCCCA
>probe:Drosophila_2:1623813_at:365:89; Interrogation_Position=953; Antisense; AGTCTTTATATAACGCGCCTGAGCC
>probe:Drosophila_2:1623813_at:445:323; Interrogation_Position=967; Antisense; GCGCCTGAGCCAAGCCATTGATGAG

Paste this into a BLAST search page for me
AAGGACTCTCCACTGCTGATTAATCACAGGACTCACCGACTTGCAATATAGCAATATAAGACACTCCTGACCGGCATATCCACCAAGTTCGTGAGCGATGATGTGGCCGATTACTTCTGGGAAATTTCCTTTACTTTTAGTAGCCCAGCTAATAGTGGCTGCCAAGCCCACAAATAACTCCTAAACTCCGATGATCCAGTAGGAGGAGACAGTCCACCTGCTGAAGCTGAACTCGTTGTTCCGATCACAAAAATCGCCTATTTCTCCGAGGTGAAAGGTGAAGGCCGCTCTGAATCCCCAAGTCTTTATATAACGCGCCTGAGCCGCGCCTGAGCCAAGCCATTGATGAG

Full Affymetrix probeset data:

Annotations for 1623813_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime