FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623814_at:

>probe:Drosophila_2:1623814_at:109:417; Interrogation_Position=131; Antisense; GAGCCGAATATCTCGTCGAACGAAT
>probe:Drosophila_2:1623814_at:363:305; Interrogation_Position=197; Antisense; CCGTGGTGATCTTCGTCATCTTCAA
>probe:Drosophila_2:1623814_at:364:217; Interrogation_Position=220; Antisense; AAGTTCTTGATTATGGAGCCGCTCT
>probe:Drosophila_2:1623814_at:206:3; Interrogation_Position=271; Antisense; ATTGGATCCGGCGTAGCCACGGTAA
>probe:Drosophila_2:1623814_at:53:495; Interrogation_Position=292; Antisense; GTAATTGTGATGCATGTCCTGGTCA
>probe:Drosophila_2:1623814_at:307:323; Interrogation_Position=330; Antisense; GCGCCTGATCTTCCTTCAAGAGATT
>probe:Drosophila_2:1623814_at:370:527; Interrogation_Position=377; Antisense; GGGAAGTTCTGATGCCACCAAACAC
>probe:Drosophila_2:1623814_at:326:647; Interrogation_Position=408; Antisense; TCATGGATCCGTGTTCATTGTCCTG
>probe:Drosophila_2:1623814_at:224:603; Interrogation_Position=437; Antisense; TGATGTCCTACTGTTCCCTAATAAT
>probe:Drosophila_2:1623814_at:230:471; Interrogation_Position=449; Antisense; GTTCCCTAATAATTGGCTTTCCCAT
>probe:Drosophila_2:1623814_at:308:313; Interrogation_Position=475; Antisense; GCCACCTTTTTTGCCCTGAAATTTG
>probe:Drosophila_2:1623814_at:280:507; Interrogation_Position=502; Antisense; GTGCTCAAGAGCTATGCCCATATCA
>probe:Drosophila_2:1623814_at:305:685; Interrogation_Position=537; Antisense; TATTTCGACCATTTGCACCGTAGTT
>probe:Drosophila_2:1623814_at:650:113; Interrogation_Position=573; Antisense; AGCAGTTGGCTTTTACATCTACCGA

Paste this into a BLAST search page for me
GAGCCGAATATCTCGTCGAACGAATCCGTGGTGATCTTCGTCATCTTCAAAAGTTCTTGATTATGGAGCCGCTCTATTGGATCCGGCGTAGCCACGGTAAGTAATTGTGATGCATGTCCTGGTCAGCGCCTGATCTTCCTTCAAGAGATTGGGAAGTTCTGATGCCACCAAACACTCATGGATCCGTGTTCATTGTCCTGTGATGTCCTACTGTTCCCTAATAATGTTCCCTAATAATTGGCTTTCCCATGCCACCTTTTTTGCCCTGAAATTTGGTGCTCAAGAGCTATGCCCATATCATATTTCGACCATTTGCACCGTAGTTAGCAGTTGGCTTTTACATCTACCGA

Full Affymetrix probeset data:

Annotations for 1623814_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720