FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623815_at:

>probe:Drosophila_2:1623815_at:192:511; Interrogation_Position=1420; Antisense; GTGACCTTCGAAGAAACCATGACCA
>probe:Drosophila_2:1623815_at:170:609; Interrogation_Position=1439; Antisense; TGACCACGGATCTCATCAATCTAAT
>probe:Drosophila_2:1623815_at:677:111; Interrogation_Position=1469; Antisense; AGCAACTGCTTTTGTCACATCGCAA
>probe:Drosophila_2:1623815_at:408:247; Interrogation_Position=1502; Antisense; AATTCCTGCGTCGTAATCTTGTGGC
>probe:Drosophila_2:1623815_at:125:91; Interrogation_Position=1558; Antisense; AGTATTGGCCTGGATATAGTTGCTC
>probe:Drosophila_2:1623815_at:681:93; Interrogation_Position=1575; Antisense; AGTTGCTCCAGAGAACCTGGTCGTT
>probe:Drosophila_2:1623815_at:166:425; Interrogation_Position=1635; Antisense; GAGACTGCGTTTACATCTGGATAGC
>probe:Drosophila_2:1623815_at:234:287; Interrogation_Position=1651; Antisense; CTGGATAGCTTTAAGTGTTCCCTAA
>probe:Drosophila_2:1623815_at:435:663; Interrogation_Position=1685; Antisense; TAAATCACTTCGAACGCCAATTCCC
>probe:Drosophila_2:1623815_at:488:511; Interrogation_Position=1736; Antisense; GTGAGCTTTATGAGGCCGACTACGC
>probe:Drosophila_2:1623815_at:544:69; Interrogation_Position=1748; Antisense; AGGCCGACTACGCATCAACAGATGT
>probe:Drosophila_2:1623815_at:322:99; Interrogation_Position=1767; Antisense; AGATGTGACCACTTCCAACCGATTC
>probe:Drosophila_2:1623815_at:711:227; Interrogation_Position=1867; Antisense; AATGGCCTGGAGTCGCATTTCGATG
>probe:Drosophila_2:1623815_at:673:453; Interrogation_Position=1932; Antisense; GATAATCTTTCATAACCAGGCCTAA

Paste this into a BLAST search page for me
GTGACCTTCGAAGAAACCATGACCATGACCACGGATCTCATCAATCTAATAGCAACTGCTTTTGTCACATCGCAAAATTCCTGCGTCGTAATCTTGTGGCAGTATTGGCCTGGATATAGTTGCTCAGTTGCTCCAGAGAACCTGGTCGTTGAGACTGCGTTTACATCTGGATAGCCTGGATAGCTTTAAGTGTTCCCTAATAAATCACTTCGAACGCCAATTCCCGTGAGCTTTATGAGGCCGACTACGCAGGCCGACTACGCATCAACAGATGTAGATGTGACCACTTCCAACCGATTCAATGGCCTGGAGTCGCATTTCGATGGATAATCTTTCATAACCAGGCCTAA

Full Affymetrix probeset data:

Annotations for 1623815_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720