Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623816_s_at:

>probe:Drosophila_2:1623816_s_at:443:325; Interrogation_Position=455; Antisense; GCGAACAAACCAGCGGCCACAAATG
>probe:Drosophila_2:1623816_s_at:434:377; Interrogation_Position=572; Antisense; GAAGCAGCTGCCAAGCATTTAATGA
>probe:Drosophila_2:1623816_s_at:143:17; Interrogation_Position=588; Antisense; ATTTAATGACTCACCATCACATCCT
>probe:Drosophila_2:1623816_s_at:186:35; Interrogation_Position=603; Antisense; ATCACATCCTCAGACCGACATAAGA
>probe:Drosophila_2:1623816_s_at:120:577; Interrogation_Position=688; Antisense; GGCGCATTACCTATATTAACCTGCT
>probe:Drosophila_2:1623816_s_at:170:689; Interrogation_Position=743; Antisense; TATTTTGCCAAGCAGCACTCCAAGT
>probe:Drosophila_2:1623816_s_at:510:305; Interrogation_Position=783; Antisense; CCTTTCATTTTCATGTCCCACATTT
>probe:Drosophila_2:1623816_s_at:574:503; Interrogation_Position=797; Antisense; GTCCCACATTTGTTCTATTGTCTAA
>probe:Drosophila_2:1623816_s_at:697:707; Interrogation_Position=858; Antisense; TTAAGTAACTCGTGATTCCGCCCCA
>probe:Drosophila_2:1623816_s_at:288:463; Interrogation_Position=871; Antisense; GATTCCGCCCCACAAATACGGATGA
>probe:Drosophila_2:1623816_s_at:54:721; Interrogation_Position=902; Antisense; TTGACTTTGCTAAAATCTACCACCT
>probe:Drosophila_2:1623816_s_at:270:643; Interrogation_Position=917; Antisense; TCTACCACCTACTAAGCCTAATTTA
>probe:Drosophila_2:1623816_s_at:463:221; Interrogation_Position=955; Antisense; AAGTGTCCAATCGAATCTTCTTATA
>probe:Drosophila_2:1623816_s_at:451:675; Interrogation_Position=978; Antisense; TAGTCTGTAAAATTCGTCCAAACGA

Paste this into a BLAST search page for me
GCGAACAAACCAGCGGCCACAAATGGAAGCAGCTGCCAAGCATTTAATGAATTTAATGACTCACCATCACATCCTATCACATCCTCAGACCGACATAAGAGGCGCATTACCTATATTAACCTGCTTATTTTGCCAAGCAGCACTCCAAGTCCTTTCATTTTCATGTCCCACATTTGTCCCACATTTGTTCTATTGTCTAATTAAGTAACTCGTGATTCCGCCCCAGATTCCGCCCCACAAATACGGATGATTGACTTTGCTAAAATCTACCACCTTCTACCACCTACTAAGCCTAATTTAAAGTGTCCAATCGAATCTTCTTATATAGTCTGTAAAATTCGTCCAAACGA

Full Affymetrix probeset data:

Annotations for 1623816_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime