FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623817_at:

>probe:Drosophila_2:1623817_at:24:373; Interrogation_Position=369; Antisense; GAAGGTCAGCTACACCTTTAGCAAG
>probe:Drosophila_2:1623817_at:423:191; Interrogation_Position=412; Antisense; AACTTCCCAGAGCTGAAGGCCAGTG
>probe:Drosophila_2:1623817_at:483:227; Interrogation_Position=427; Antisense; AAGGCCAGTGCCCACTATTTGGACA
>probe:Drosophila_2:1623817_at:609:253; Interrogation_Position=453; Antisense; CAACACCTTTGTGAATCTGCTGAAG
>probe:Drosophila_2:1623817_at:184:365; Interrogation_Position=534; Antisense; GAATCTGTCGATTCAGGGCGAGTTC
>probe:Drosophila_2:1623817_at:557:429; Interrogation_Position=553; Antisense; GAGTTCAAGTACAAGATGCCCTTCA
>probe:Drosophila_2:1623817_at:306:451; Interrogation_Position=594; Antisense; GATCTACAAGTTCAGTTGCGCCGTC
>probe:Drosophila_2:1623817_at:378:575; Interrogation_Position=625; Antisense; GGCGGTGTATCCTCGAACATTGGCG
>probe:Drosophila_2:1623817_at:497:429; Interrogation_Position=676; Antisense; GAGTTCATCAACGACATGCTCGACA
>probe:Drosophila_2:1623817_at:240:97; Interrogation_Position=704; Antisense; AGATCCCGGCCTTCATCAATGGCAA
>probe:Drosophila_2:1623817_at:442:43; Interrogation_Position=751; Antisense; ATCGAGGAGATCTTTGTGCCGCTGG
>probe:Drosophila_2:1623817_at:502:233; Interrogation_Position=778; Antisense; AATGCGCATCTCACGGGTCACAAGA
>probe:Drosophila_2:1623817_at:474:539; Interrogation_Position=806; Antisense; GGTATCTCTTTAGCTTGCTGTCCGC
>probe:Drosophila_2:1623817_at:650:465; Interrogation_Position=867; Antisense; GTTGGCCATTGAGTCCAGGAAGCTA

Paste this into a BLAST search page for me
GAAGGTCAGCTACACCTTTAGCAAGAACTTCCCAGAGCTGAAGGCCAGTGAAGGCCAGTGCCCACTATTTGGACACAACACCTTTGTGAATCTGCTGAAGGAATCTGTCGATTCAGGGCGAGTTCGAGTTCAAGTACAAGATGCCCTTCAGATCTACAAGTTCAGTTGCGCCGTCGGCGGTGTATCCTCGAACATTGGCGGAGTTCATCAACGACATGCTCGACAAGATCCCGGCCTTCATCAATGGCAAATCGAGGAGATCTTTGTGCCGCTGGAATGCGCATCTCACGGGTCACAAGAGGTATCTCTTTAGCTTGCTGTCCGCGTTGGCCATTGAGTCCAGGAAGCTA

Full Affymetrix probeset data:

Annotations for 1623817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720