FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623819_at:

>probe:Drosophila_2:1623819_at:44:441; Interrogation_Position=1769; Antisense; GATGGCCAGCGAAACTTTTGCGGTC
>probe:Drosophila_2:1623819_at:336:335; Interrogation_Position=1855; Antisense; GCTCCCAGGAAGATTTCGATTCGCT
>probe:Drosophila_2:1623819_at:420:439; Interrogation_Position=1899; Antisense; GAGGCTTTGCAGTCGATTGTCAACC
>probe:Drosophila_2:1623819_at:708:157; Interrogation_Position=1936; Antisense; ACAACCATTTGCTACTGCTCGTCTT
>probe:Drosophila_2:1623819_at:422:323; Interrogation_Position=1977; Antisense; GCGCATTTGTCGCAATCCTCGAAAG
>probe:Drosophila_2:1623819_at:191:637; Interrogation_Position=1995; Antisense; TCGAAAGCTGCGTTGGATCTGGCCG
>probe:Drosophila_2:1623819_at:561:69; Interrogation_Position=2032; Antisense; AGGCCACCTTTGACTATGCCATCAA
>probe:Drosophila_2:1623819_at:542:551; Interrogation_Position=2066; Antisense; GGAGACACGTGTACTCAACTATGTA
>probe:Drosophila_2:1623819_at:577:681; Interrogation_Position=2085; Antisense; TATGTACTGATGCAGCTCCGTTTGT
>probe:Drosophila_2:1623819_at:487:469; Interrogation_Position=2108; Antisense; GTTGCCCTGCAAGGAGGTATTCCAT
>probe:Drosophila_2:1623819_at:565:107; Interrogation_Position=2149; Antisense; AGAACTGTCGATTTGCTCTTCGCGA
>probe:Drosophila_2:1623819_at:8:439; Interrogation_Position=2172; Antisense; GAGGCTCTCAAGCAACCAACGTTTG
>probe:Drosophila_2:1623819_at:301:375; Interrogation_Position=2264; Antisense; GAAGAGATTACCTTTATTTCCCACT
>probe:Drosophila_2:1623819_at:6:633; Interrogation_Position=2290; Antisense; TCCGATTTGTGTAGCTTTCGCGAAT

Paste this into a BLAST search page for me
GATGGCCAGCGAAACTTTTGCGGTCGCTCCCAGGAAGATTTCGATTCGCTGAGGCTTTGCAGTCGATTGTCAACCACAACCATTTGCTACTGCTCGTCTTGCGCATTTGTCGCAATCCTCGAAAGTCGAAAGCTGCGTTGGATCTGGCCGAGGCCACCTTTGACTATGCCATCAAGGAGACACGTGTACTCAACTATGTATATGTACTGATGCAGCTCCGTTTGTGTTGCCCTGCAAGGAGGTATTCCATAGAACTGTCGATTTGCTCTTCGCGAGAGGCTCTCAAGCAACCAACGTTTGGAAGAGATTACCTTTATTTCCCACTTCCGATTTGTGTAGCTTTCGCGAAT

Full Affymetrix probeset data:

Annotations for 1623819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720