Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623820_at:

>probe:Drosophila_2:1623820_at:389:413; Interrogation_Position=2589; Antisense; GACCTGGAGCTTGGATCCGAGTCCA
>probe:Drosophila_2:1623820_at:364:675; Interrogation_Position=2674; Antisense; TAGAAAGGGAGTTCCTCGGCCTGGA
>probe:Drosophila_2:1623820_at:106:305; Interrogation_Position=2693; Antisense; CCTGGAGGACTTTGACATGTAGAAA
>probe:Drosophila_2:1623820_at:66:247; Interrogation_Position=2716; Antisense; AATTCTGTAGCATCTGTGAACACCA
>probe:Drosophila_2:1623820_at:354:511; Interrogation_Position=2731; Antisense; GTGAACACCAGACAGGGCCATGAGA
>probe:Drosophila_2:1623820_at:360:57; Interrogation_Position=2750; Antisense; ATGAGACCCCGCGTTGGAGGCATCC
>probe:Drosophila_2:1623820_at:117:403; Interrogation_Position=2801; Antisense; GACATATTTGATTCTCGGTAGACCA
>probe:Drosophila_2:1623820_at:182:287; Interrogation_Position=2848; Antisense; CTGTGTCCTTGAGTAGAGCGTCCAA
>probe:Drosophila_2:1623820_at:729:417; Interrogation_Position=2863; Antisense; GAGCGTCCAACTACACTTATGCTTA
>probe:Drosophila_2:1623820_at:546:275; Interrogation_Position=2878; Antisense; CTTATGCTTAGGGTTCGTACTGTAT
>probe:Drosophila_2:1623820_at:308:675; Interrogation_Position=2931; Antisense; TAGCCTGTAAGATAGCGCACACGTG
>probe:Drosophila_2:1623820_at:456:79; Interrogation_Position=2965; Antisense; AGGTCCTTCAATCGCGTACATTCTT
>probe:Drosophila_2:1623820_at:201:305; Interrogation_Position=3063; Antisense; CCGTTTCAGCGGACTAGTACCTAGT
>probe:Drosophila_2:1623820_at:689:369; Interrogation_Position=3103; Antisense; GAATGTACACCACACCAGTAGTTGT

Paste this into a BLAST search page for me
GACCTGGAGCTTGGATCCGAGTCCATAGAAAGGGAGTTCCTCGGCCTGGACCTGGAGGACTTTGACATGTAGAAAAATTCTGTAGCATCTGTGAACACCAGTGAACACCAGACAGGGCCATGAGAATGAGACCCCGCGTTGGAGGCATCCGACATATTTGATTCTCGGTAGACCACTGTGTCCTTGAGTAGAGCGTCCAAGAGCGTCCAACTACACTTATGCTTACTTATGCTTAGGGTTCGTACTGTATTAGCCTGTAAGATAGCGCACACGTGAGGTCCTTCAATCGCGTACATTCTTCCGTTTCAGCGGACTAGTACCTAGTGAATGTACACCACACCAGTAGTTGT

Full Affymetrix probeset data:

Annotations for 1623820_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime