FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623821_at:

>probe:Drosophila_2:1623821_at:20:109; Interrogation_Position=1150; Antisense; AGAAGCCCAATTTCTACCTGATTCC
>probe:Drosophila_2:1623821_at:728:313; Interrogation_Position=1185; Antisense; GCCAGTCAGGCATCCGGTGATGGTA
>probe:Drosophila_2:1623821_at:239:629; Interrogation_Position=1220; Antisense; TGCCAATGTCCTGCTTCCAATAAAT
>probe:Drosophila_2:1623821_at:345:567; Interrogation_Position=1271; Antisense; GGCTCCAGAGCTGACCCAGGGTAAA
>probe:Drosophila_2:1623821_at:715:637; Interrogation_Position=1305; Antisense; TCGGGCAGCATCAGTTTCCAGGATC
>probe:Drosophila_2:1623821_at:693:603; Interrogation_Position=1330; Antisense; TGATTAAGGCCACCAATGTCCATGT
>probe:Drosophila_2:1623821_at:108:63; Interrogation_Position=1345; Antisense; ATGTCCATGTGAGCCAGCCCATCAA
>probe:Drosophila_2:1623821_at:11:187; Interrogation_Position=1380; Antisense; AACAATGGCCTCACTCAAGTGCAGA
>probe:Drosophila_2:1623821_at:175:95; Interrogation_Position=1426; Antisense; AGTTGATCCTCAGTCATCTTAGCGA
>probe:Drosophila_2:1623821_at:517:467; Interrogation_Position=1479; Antisense; GTTGCGGACGGAAAGCGCTCCCAAT
>probe:Drosophila_2:1623821_at:456:101; Interrogation_Position=1540; Antisense; AGAGCTCCGTTCTGTTTGCCGTGGA
>probe:Drosophila_2:1623821_at:675:721; Interrogation_Position=1555; Antisense; TTGCCGTGGAGATTCCGAAGCCCAT
>probe:Drosophila_2:1623821_at:321:307; Interrogation_Position=1576; Antisense; CCATCTATCGCTTCTTCAAGGGCAT
>probe:Drosophila_2:1623821_at:176:575; Interrogation_Position=1605; Antisense; GGCGGTTTCTCCAACTGAGAGGCTA

Paste this into a BLAST search page for me
AGAAGCCCAATTTCTACCTGATTCCGCCAGTCAGGCATCCGGTGATGGTATGCCAATGTCCTGCTTCCAATAAATGGCTCCAGAGCTGACCCAGGGTAAATCGGGCAGCATCAGTTTCCAGGATCTGATTAAGGCCACCAATGTCCATGTATGTCCATGTGAGCCAGCCCATCAAAACAATGGCCTCACTCAAGTGCAGAAGTTGATCCTCAGTCATCTTAGCGAGTTGCGGACGGAAAGCGCTCCCAATAGAGCTCCGTTCTGTTTGCCGTGGATTGCCGTGGAGATTCCGAAGCCCATCCATCTATCGCTTCTTCAAGGGCATGGCGGTTTCTCCAACTGAGAGGCTA

Full Affymetrix probeset data:

Annotations for 1623821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720