Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623823_a_at:

>probe:Drosophila_2:1623823_a_at:5:555; Interrogation_Position=1001; Antisense; GGAGCTGTTCTCTATGGAACGCCAA
>probe:Drosophila_2:1623823_a_at:405:233; Interrogation_Position=1029; Antisense; AATGCTGACACTGAAGAGCCGGCTT
>probe:Drosophila_2:1623823_a_at:678:415; Interrogation_Position=1044; Antisense; GAGCCGGCTTCATTGAAATCTCTTG
>probe:Drosophila_2:1623823_a_at:55:417; Interrogation_Position=1086; Antisense; GAGACCGAATGGGTTCCTGAAAGAA
>probe:Drosophila_2:1623823_a_at:464:55; Interrogation_Position=1120; Antisense; ATGAAGCTGATTACGATCCACTCGA
>probe:Drosophila_2:1623823_a_at:552:473; Interrogation_Position=1209; Antisense; GTTCAACGATTGAGCCATACCAGGA
>probe:Drosophila_2:1623823_a_at:643:125; Interrogation_Position=1221; Antisense; AGCCATACCAGGATTTGCCCAAATT
>probe:Drosophila_2:1623823_a_at:35:163; Interrogation_Position=1241; Antisense; AAATTCCAGAGTCGATCCACCGGTT
>probe:Drosophila_2:1623823_a_at:600:547; Interrogation_Position=681; Antisense; GGAGTTCCGGATTCCCAATTTGAGA
>probe:Drosophila_2:1623823_a_at:408:299; Interrogation_Position=818; Antisense; CGCGCCTCGTATGGTCGAAGCTAAA
>probe:Drosophila_2:1623823_a_at:605:99; Interrogation_Position=911; Antisense; AGAGGATACCACTCATCCAGGAATA
>probe:Drosophila_2:1623823_a_at:139:687; Interrogation_Position=951; Antisense; TATAGGCGCAATACTCATTTTGAGT
>probe:Drosophila_2:1623823_a_at:307:433; Interrogation_Position=972; Antisense; GAGTGCTTGGGAATTCCTCTAACTT
>probe:Drosophila_2:1623823_a_at:594:245; Interrogation_Position=983; Antisense; AATTCCTCTAACTTCCTTGGAGCTG

Paste this into a BLAST search page for me
GGAGCTGTTCTCTATGGAACGCCAAAATGCTGACACTGAAGAGCCGGCTTGAGCCGGCTTCATTGAAATCTCTTGGAGACCGAATGGGTTCCTGAAAGAAATGAAGCTGATTACGATCCACTCGAGTTCAACGATTGAGCCATACCAGGAAGCCATACCAGGATTTGCCCAAATTAAATTCCAGAGTCGATCCACCGGTTGGAGTTCCGGATTCCCAATTTGAGACGCGCCTCGTATGGTCGAAGCTAAAAGAGGATACCACTCATCCAGGAATATATAGGCGCAATACTCATTTTGAGTGAGTGCTTGGGAATTCCTCTAACTTAATTCCTCTAACTTCCTTGGAGCTG

Full Affymetrix probeset data:

Annotations for 1623823_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime