FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623824_at:

>probe:Drosophila_2:1623824_at:292:375; Interrogation_Position=154; Antisense; GAAGATATCATCCTGACCATTGCCG
>probe:Drosophila_2:1623824_at:326:463; Interrogation_Position=197; Antisense; GATTGGAATTCATCTCGGTGCGAGT
>probe:Drosophila_2:1623824_at:217:389; Interrogation_Position=235; Antisense; GAAAACGCCGGTGGCACTGTGCTGA
>probe:Drosophila_2:1623824_at:492:607; Interrogation_Position=303; Antisense; TGATGTGGCCATACTCCAGCTGAGA
>probe:Drosophila_2:1623824_at:271:285; Interrogation_Position=322; Antisense; CTGAGATCGCCGCTGTACTTGGACG
>probe:Drosophila_2:1623824_at:257:129; Interrogation_Position=373; Antisense; ACCATACCATTAGTGCCGGGAACGA
>probe:Drosophila_2:1623824_at:367:377; Interrogation_Position=392; Antisense; GAACGAATGCCTCCGTTTCGGGTTG
>probe:Drosophila_2:1623824_at:652:281; Interrogation_Position=428; Antisense; CTGCCATGAATCCTTCGTCGGAAGT
>probe:Drosophila_2:1623824_at:650:5; Interrogation_Position=486; Antisense; ATTGATGTGCGCGACAAACCTTGCT
>probe:Drosophila_2:1623824_at:408:105; Interrogation_Position=561; Antisense; AGAAATTCCCTACGCCTGTCAAGGA
>probe:Drosophila_2:1623824_at:698:31; Interrogation_Position=611; Antisense; ATAATCGGCTGTATGGAATCCTTTC
>probe:Drosophila_2:1623824_at:672:363; Interrogation_Position=626; Antisense; GAATCCTTTCCTGGCAAAGTGCCTG
>probe:Drosophila_2:1623824_at:388:305; Interrogation_Position=647; Antisense; CCTGCGACGTCCTCAATAAATCTAG
>probe:Drosophila_2:1623824_at:299:515; Interrogation_Position=671; Antisense; GTGTCTATGCCAATATCGCGATGTT

Paste this into a BLAST search page for me
GAAGATATCATCCTGACCATTGCCGGATTGGAATTCATCTCGGTGCGAGTGAAAACGCCGGTGGCACTGTGCTGATGATGTGGCCATACTCCAGCTGAGACTGAGATCGCCGCTGTACTTGGACGACCATACCATTAGTGCCGGGAACGAGAACGAATGCCTCCGTTTCGGGTTGCTGCCATGAATCCTTCGTCGGAAGTATTGATGTGCGCGACAAACCTTGCTAGAAATTCCCTACGCCTGTCAAGGAATAATCGGCTGTATGGAATCCTTTCGAATCCTTTCCTGGCAAAGTGCCTGCCTGCGACGTCCTCAATAAATCTAGGTGTCTATGCCAATATCGCGATGTT

Full Affymetrix probeset data:

Annotations for 1623824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720