FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623829_at:

>probe:Drosophila_2:1623829_at:526:593; Interrogation_Position=13; Antisense; TGGGATCACCTTACTGGCGACTGTA
>probe:Drosophila_2:1623829_at:264:461; Interrogation_Position=140; Antisense; GATTATTCGAAAGCAGTCCGGCCTG
>probe:Drosophila_2:1623829_at:198:715; Interrogation_Position=172; Antisense; TTCTGAGCTCAGTTGTGGACGGGCC
>probe:Drosophila_2:1623829_at:71:683; Interrogation_Position=236; Antisense; TATGAAGACACCACTGCTTGGCTTT
>probe:Drosophila_2:1623829_at:97:345; Interrogation_Position=251; Antisense; GCTTGGCTTTCTTACTACAGTGATC
>probe:Drosophila_2:1623829_at:681:153; Interrogation_Position=267; Antisense; ACAGTGATCGCAATCTCTGCAGGTA
>probe:Drosophila_2:1623829_at:560:79; Interrogation_Position=287; Antisense; AGGTATTTGCCCTGCGATTTGCGCG
>probe:Drosophila_2:1623829_at:180:459; Interrogation_Position=302; Antisense; GATTTGCGCGAAACGAGCCATGGAA
>probe:Drosophila_2:1623829_at:669:561; Interrogation_Position=323; Antisense; GGAAGCGTGTGTGTCTGCAACAGCA
>probe:Drosophila_2:1623829_at:478:353; Interrogation_Position=345; Antisense; GCACCTACTGCGATTATCTGGAACC
>probe:Drosophila_2:1623829_at:87:119; Interrogation_Position=375; Antisense; AGCTCACTGATATCTCGCAGATTGT
>probe:Drosophila_2:1623829_at:678:361; Interrogation_Position=414; Antisense; GCAAGGATGGCTTACGCTTCAAGAA
>probe:Drosophila_2:1623829_at:697:535; Interrogation_Position=51; Antisense; GGTCCGGCTGCTTTATCAAATCAAC
>probe:Drosophila_2:1623829_at:615:149; Interrogation_Position=561; Antisense; ACATTCCCCAAAGCCTGTGTAACTA

Paste this into a BLAST search page for me
TGGGATCACCTTACTGGCGACTGTAGATTATTCGAAAGCAGTCCGGCCTGTTCTGAGCTCAGTTGTGGACGGGCCTATGAAGACACCACTGCTTGGCTTTGCTTGGCTTTCTTACTACAGTGATCACAGTGATCGCAATCTCTGCAGGTAAGGTATTTGCCCTGCGATTTGCGCGGATTTGCGCGAAACGAGCCATGGAAGGAAGCGTGTGTGTCTGCAACAGCAGCACCTACTGCGATTATCTGGAACCAGCTCACTGATATCTCGCAGATTGTGCAAGGATGGCTTACGCTTCAAGAAGGTCCGGCTGCTTTATCAAATCAACACATTCCCCAAAGCCTGTGTAACTA

Full Affymetrix probeset data:

Annotations for 1623829_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720