FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623830_at:

>probe:Drosophila_2:1623830_at:599:105; Interrogation_Position=2554; Antisense; AGACTTTGTTGGGTGCCAGCGGCAT
>probe:Drosophila_2:1623830_at:675:7; Interrogation_Position=2577; Antisense; ATTGCGGCCACCATTGTTCTGCCAA
>probe:Drosophila_2:1623830_at:257:5; Interrogation_Position=2589; Antisense; ATTGTTCTGCCAATGACTCCCACAT
>probe:Drosophila_2:1623830_at:574:41; Interrogation_Position=2646; Antisense; ATCGAGCTGAGCTCGGCCAAACGGG
>probe:Drosophila_2:1623830_at:430:525; Interrogation_Position=2669; Antisense; GGGCACCCTGAAGAGATTGGTCAAT
>probe:Drosophila_2:1623830_at:11:539; Interrogation_Position=2687; Antisense; GGTCAATTCACCCAATATGTTTAAA
>probe:Drosophila_2:1623830_at:42:399; Interrogation_Position=2772; Antisense; GACACCCAGGAAAACATATTCGGCG
>probe:Drosophila_2:1623830_at:528:639; Interrogation_Position=2799; Antisense; TCGGAATCCGAGGTTCCCATGGGTA
>probe:Drosophila_2:1623830_at:680:61; Interrogation_Position=2817; Antisense; ATGGGTAAAGCCACCGATCACCGGT
>probe:Drosophila_2:1623830_at:298:241; Interrogation_Position=2849; Antisense; GAATTCGGTTAATCCCTTTGCTATG
>probe:Drosophila_2:1623830_at:510:195; Interrogation_Position=2881; Antisense; AACTGGGCGACACTGGAGTCATCTT
>probe:Drosophila_2:1623830_at:152:143; Interrogation_Position=2892; Antisense; ACTGGAGTCATCTTTGGATCCGAAA
>probe:Drosophila_2:1623830_at:485:513; Interrogation_Position=2992; Antisense; GTGTAACGTTTATCCCATTCTGTGA
>probe:Drosophila_2:1623830_at:612:45; Interrogation_Position=3003; Antisense; ATCCCATTCTGTGAGCTACATGTAA

Paste this into a BLAST search page for me
AGACTTTGTTGGGTGCCAGCGGCATATTGCGGCCACCATTGTTCTGCCAAATTGTTCTGCCAATGACTCCCACATATCGAGCTGAGCTCGGCCAAACGGGGGGCACCCTGAAGAGATTGGTCAATGGTCAATTCACCCAATATGTTTAAAGACACCCAGGAAAACATATTCGGCGTCGGAATCCGAGGTTCCCATGGGTAATGGGTAAAGCCACCGATCACCGGTGAATTCGGTTAATCCCTTTGCTATGAACTGGGCGACACTGGAGTCATCTTACTGGAGTCATCTTTGGATCCGAAAGTGTAACGTTTATCCCATTCTGTGAATCCCATTCTGTGAGCTACATGTAA

Full Affymetrix probeset data:

Annotations for 1623830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720