Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623833_at:

>probe:Drosophila_2:1623833_at:304:261; Interrogation_Position=1419; Antisense; CACCGCGTTGCACAATCAGTTTTTG
>probe:Drosophila_2:1623833_at:172:527; Interrogation_Position=1485; Antisense; GGGCAATGTCAGACCTTTTCAATTT
>probe:Drosophila_2:1623833_at:7:131; Interrogation_Position=1497; Antisense; ACCTTTTCAATTTCTGCTGGGCGGA
>probe:Drosophila_2:1623833_at:171:373; Interrogation_Position=1520; Antisense; GAAGTATCCTGACGCTTTTCATGTT
>probe:Drosophila_2:1623833_at:384:697; Interrogation_Position=1536; Antisense; TTTCATGTTCTGCACAATCGCTGGA
>probe:Drosophila_2:1623833_at:466:235; Interrogation_Position=1551; Antisense; AATCGCTGGATTCACCATCTTGTTC
>probe:Drosophila_2:1623833_at:586:353; Interrogation_Position=1577; Antisense; GCACCATGGTGCTCTGAATTCAACT
>probe:Drosophila_2:1623833_at:539:191; Interrogation_Position=1608; Antisense; AACTTCATTTCAGTTCAGCCATCCA
>probe:Drosophila_2:1623833_at:700:259; Interrogation_Position=1623; Antisense; CAGCCATCCAAATTTCCGTTTCGAT
>probe:Drosophila_2:1623833_at:387:693; Interrogation_Position=1641; Antisense; TTTCGATTTCTCTCAACCGCATTTG
>probe:Drosophila_2:1623833_at:308:421; Interrogation_Position=1706; Antisense; GAGCAATCTTGTTGACACGTTTAGC
>probe:Drosophila_2:1623833_at:162:535; Interrogation_Position=1789; Antisense; GGTCCACGAAAATTCAGCTCCACGG
>probe:Drosophila_2:1623833_at:179:263; Interrogation_Position=1803; Antisense; CAGCTCCACGGACAGGTGATGGCAA
>probe:Drosophila_2:1623833_at:270:479; Interrogation_Position=1975; Antisense; GTTTCAAAACGTAGCCATTGCCAAT

Paste this into a BLAST search page for me
CACCGCGTTGCACAATCAGTTTTTGGGGCAATGTCAGACCTTTTCAATTTACCTTTTCAATTTCTGCTGGGCGGAGAAGTATCCTGACGCTTTTCATGTTTTTCATGTTCTGCACAATCGCTGGAAATCGCTGGATTCACCATCTTGTTCGCACCATGGTGCTCTGAATTCAACTAACTTCATTTCAGTTCAGCCATCCACAGCCATCCAAATTTCCGTTTCGATTTTCGATTTCTCTCAACCGCATTTGGAGCAATCTTGTTGACACGTTTAGCGGTCCACGAAAATTCAGCTCCACGGCAGCTCCACGGACAGGTGATGGCAAGTTTCAAAACGTAGCCATTGCCAAT

Full Affymetrix probeset data:

Annotations for 1623833_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime