Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623834_at:

>probe:Drosophila_2:1623834_at:604:409; Interrogation_Position=490; Antisense; GACGACCTGCACTTCATTGGCTACA
>probe:Drosophila_2:1623834_at:606:3; Interrogation_Position=505; Antisense; ATTGGCTACAGTGTGGGTGCCCACA
>probe:Drosophila_2:1623834_at:636:303; Interrogation_Position=533; Antisense; CCGGTCTGGTGGCTAACTATTTGAA
>probe:Drosophila_2:1623834_at:499:589; Interrogation_Position=593; Antisense; TGGATCCCACGATATTCTTCTATGC
>probe:Drosophila_2:1623834_at:653:451; Interrogation_Position=637; Antisense; GATCTGGATTCGACGGATGCACACT
>probe:Drosophila_2:1623834_at:618:445; Interrogation_Position=652; Antisense; GATGCACACTTCGTGGATGTTCTGC
>probe:Drosophila_2:1623834_at:567:443; Interrogation_Position=667; Antisense; GATGTTCTGCACACCGGAGCTGGAA
>probe:Drosophila_2:1623834_at:386:9; Interrogation_Position=707; Antisense; ATTCCAGTGGTCATGCGGACTTCTA
>probe:Drosophila_2:1623834_at:259:557; Interrogation_Position=723; Antisense; GGACTTCTATGTCAACGGCGGCACG
>probe:Drosophila_2:1623834_at:556:591; Interrogation_Position=762; Antisense; TGTGGGTTCGGCAACCTTGTTTCAA
>probe:Drosophila_2:1623834_at:382:651; Interrogation_Position=783; Antisense; TCAAACGTTGGCTTGTGATCACACA
>probe:Drosophila_2:1623834_at:681:257; Interrogation_Position=813; Antisense; CACGCCGTACTTTATTGAATCCATC
>probe:Drosophila_2:1623834_at:74:459; Interrogation_Position=851; Antisense; GATTTTATGCGGGTCCTTGTCCCAA
>probe:Drosophila_2:1623834_at:531:515; Interrogation_Position=900; Antisense; GTGTGAGCCCAAGGACTCGGAGTAT

Paste this into a BLAST search page for me
GACGACCTGCACTTCATTGGCTACAATTGGCTACAGTGTGGGTGCCCACACCGGTCTGGTGGCTAACTATTTGAATGGATCCCACGATATTCTTCTATGCGATCTGGATTCGACGGATGCACACTGATGCACACTTCGTGGATGTTCTGCGATGTTCTGCACACCGGAGCTGGAAATTCCAGTGGTCATGCGGACTTCTAGGACTTCTATGTCAACGGCGGCACGTGTGGGTTCGGCAACCTTGTTTCAATCAAACGTTGGCTTGTGATCACACACACGCCGTACTTTATTGAATCCATCGATTTTATGCGGGTCCTTGTCCCAAGTGTGAGCCCAAGGACTCGGAGTAT

Full Affymetrix probeset data:

Annotations for 1623834_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime